Search PubMed⌕ Search

Biomedical subjects

F P Svinarchuk

Publications and source records attributed to F P Svinarchuk.

At least 19 recordsLinked to original sources
PubMed1995

Gene-targeted inhibition of transactivation of human immunodeficiency virus type-1 (HIV-1)-LTR by antisense oligonucleotides.

We have used an in vitro approach to study the efficiency of antisense oligonucleotides in inhibiting LTR-(HIV-1)-directed CAT expression catalyzed by tat protein, the functional protein of the transactivator gene. We selected the target sequence localized near the 5' end of the tat mRNA. The following conclusions can be drawn from the data presented here: a) Antisense oligonucleotides modified by conjugation of cholesterol at the 3' end have a severalfold higher inhibitory response, b) inhibitory response is dependent on the mode of introducing oligonucleotides, and c) the inhibition by antisense oligonucleotides is sequence specific and directed towards the targeted region. This approach could be useful for targeting functional regions of regulatory gene products and designing gene-targeted inhibitors of virus replication.

Animals↗
PubMed1994

Antisense oligonucleotide complementary to endogenous retroviral MCF env gene inhibits both BFU-E and CFU-S colony formation in mice.

A possible biologic activity of endogenously expressed env sequence of retroviral mink cell focus-forming virus (MCF) genome for hematopoietic colony formation was studied in mice. Antisense 20-mer complementary to MCF env sequence was used to detect the result of blockage of this gene translation on the potency of marrow cells to form colonies of erythroid (BFU-E), myeloid granulocyte-macrophage (CFU-GM), and stem cell (day 11 CFU-S) hematopoietic compartments. A large relative decrease in BFU-E number was found in bone marrow cell cultures preincubated with antisense oligonucleotide during 4 h, whereas CFU-GM colonies remained unaffected. A marked reduction of CFU-S colony formation was also registered under antisense oligomer influence. Following a decreased proliferation of erythroid progenitors, we suggest the mechanism by which antisense oligonucleotide could cause the loss of colony formation. Taken together, these data allow to propose that the expression of this gene is naturally significant for hematopoietic progenitor activity exerting some property of env gene products to regulate the growth of erythroid and multilineage hematopoietic precursors.

Amino Acid Sequence↗
PubMed1993

c-fos gene expression in cell revertants from a transformed to a pseudonormal phenotype.

c-fos gene expression in two types of mouse sarcoma cells of spontaneous origin and in revertants to pseudonormal phenotype has been investigated. In the latter cells the content of c-fos mRNA is similar to that in normal fibroblasts. Activity of transcription factors interacting with the regulatory elements, SRE, DSE and TRE, in the c-fos promoter do not correlate with the c-fos mRNA concentration. However, experiments with cells transformed with the indicator plasmid, fos-CAT, showed that the 600 bp c-fos promoter region provides the chloramphenicol acetyltransferase activity correlating with c-fos mRNA expression in cell revertants to a pseudonormal phenotype.

Animals↗
PubMed1993

Inhibition of HIV proliferation in MT-4 cells by antisense oligonucleotide conjugated to lipophilic groups.

Anti-HIV activity of antisense oligonucleotide derivatives conjugated to lipophilic groups has been investigated. Aliphatic linear structures and cholesterol were coupled to the 5'-terminal phosphate of oligonucleotides via glycine or propylene diamine spacers. The oligonucleotides were targeted to a conserved sequence of the viral gene env, to a sequence in the negative sense viral RNA, to the 5'-terminus of the gene rev and to poly(A) sequences. The conjugation with lipophilic groups stimulated binding of oligonucleotides to cells and protected the oligonucleotides against cellular nucleases. The lipophilic derivatives of oligonucleotides containing an ester bond in the linker structure were cleaved by cellular esterases yielding oligonucleotides protected from 5'-nuclease degradation by the glycine residue. Antiviral activity of the derivatives exceeded that of the corresponding unmodified oligonucleotides. The virus suppression was sequence-specific and most pronounced in the case of the cholesteryl conjugated oligonucleotides.

Base Sequence↗
PubMed1981

[Particulate fractionation and properties of basic proteins of sperm chromatin of bivalve molluscs].

A procedure for particulate fractionation of a composite set of sperm chromatin basic proteins in bivalves consisting of histones and protamine-like proteins has been developed. Some sperm proteins in 4 specimens of molluscs were obtained in individual form using chemical methods and preparative electrophoresis. The amino acid composition of these proteins was assayed. The results obtained are discussed in terms of evolution of sperm chromatin basic proteins.

Amino Acids↗
PubMed1978

[Study of evolutionary changes in subfraction composition of histone H1 in birds].

Analysis of electrophoretic mobility of histone H1 subfractions from liver, brain and erythrocytes of 41 bird species was carried out. Subfractions of erythrocyte H1 histones from each species were compared with those of thrush Turdus musicus. The majority of species proved to possess a set of electrophoretically similar subfractions. Interspecific differences in histone H1 were mainly due to the differences in the ratio of those subfractions. The identity of the electrophoretic mobility and similar contribution to H1 histone from the respective tissues in different species permits to consider certain subfractions as homologous ones. The conservation of electrophoretic mobility for homologous subfractions of the birds of different orders shows a high evolutionary conservatism of the corresponding genes. It seems that in the course of evolution only a change in the expression of some of those genes occurs.

Animals↗
PubMedDate not supplied

[Regulation of the expression of the c-fos gene in cells, reverting from being transformed to the pseudonormal phenotype].

Regulation of c-fos expression in mice sarcoma cell lines CBA and C3H was investigated. Each of the cell lines was represented by a pair of clones: the tumorigenic and the one, which was produced from it by cloning. It was found, that c-fos expression in cells of the pseudonormal phenotype was similar to that in the normal fibroblasts. Experiments with cells reverted to pseudonormal phenotype transfected transiently or permanently with an indicator plasmid fos-cat have shown, that a 600 bp sequence of the c-fos promotor including the TATA site, provides the expression level of the chloramphenicol acetyltransferase, correlating with the level of the c-fos mRNA expression. In the tumorigenic cells, permanent high activity of the cat gene expression was observed which was comparable to that in the normal fibroblasts stimulated by the embrionic serum or TPA. Activity of the transcription factors interacting with regulatory elements SRE, DSE, TRE did not correlate with the c-fos expression level in all the cells.

Animals↗
PubMedDate not supplied

["Antisense" RNA].

Explore the source record for details and available documents.

Gene Expression Regulation↗
PubMedDate not supplied

[Dansylated amino acid separation by polyacrylamide gel electrophoresis].

The paper describes a method for separation of dansylated amino acids by polyacrylamide gel electrophoresis. The methods allows a simultaneous analysis of 20-30 samples. The sensitivity of the method is 1 x 10(-9)-1 x 10(-10) M amino acid. The method permits separation of all amino acids formed during acid hydrolysis of proteins except for two pairs: Ile, Phe and Val, Asp.

Amino Acids↗
PubMedDate not supplied

[Histone H1 from the herring Clupea harengus pallasi testis structurally resembling histone H5].

Erythrocyte- and testis-specific fractions of the lysine-rich histone of herring Clupea harengus pallasi were studied. Electrophoretically purified fractions were cleaved at residues of tyrosine and phenylalanine. The fragments thus obtained and intact proteins were investigated by the method of incomplete succinylation which permitted one to determine the number of lysine residues, the total number of arginine and histidine residues and the molecular length of polypeptides. It has been found that the testis-specific fraction has in its C-terminal half of the molecule 15 arginine residues and a high proportion of basic amino acid residues (0,49) and thereby resembles the histone H5 of birds and fishes. The N-terminal half of this fraction however is close to the somatic variants of lysine-rich histones by the number of arginine residues and by the proportion of basic amino acid residues. To the author's knowledge, the testis-specific fraction of the lysine-rich histone in fishes are described for the first time.

Amino Acid Sequence↗
PubMedDate not supplied

[Evolutionary interrelationship of histones H1 and H5 in vertebrates].

Lysine-rich histones of some amphibians and fishes were studied. Electrophoretically purified subfractions were cleaved at residues of tyrosine, methionine, aspartic acid and phenylalanine. The fragments thus obtained were investigated by the method of incomplete succinylation which permitted us to determine the number of lysine residues, positive charge in acid conditions and molecular lengths of polypeptides. It was found that in anura and shark the fraction H1a resembled the histone 5 of birds in its N-terminal half part of the molecule. However this fraction proved to be non-tissue-specific. Other histone 1 fractions characteristic for vertebrates were represented in the present study by molecular variant H1s which was different from H1a fraction by the number and position of tyrosine, methionine and aspartic acid residues. The erythrocyte-specific fraction of the lysine rich histone was found in the following families of fishes: Salmonidae, Percidae and Cyprinidae. A high degree of homology in the structure of N-terminal half of H1s and histone 5 of fishes has been observed. On the basis of these results we propose a hypothesis of the independent origin of the avian and fish H5 from different fractions of H1.

Amino Acid Sequence↗
PubMedDate not supplied

[Histone H1 of reptiles, homologous to histone H5 of birds].

Lysine-rich histone H1 of animals from three reptilian orders was studied. Electrophoretically pure H1 histone subfractions were cleaved at residues of tyrosine, methionine, aspartic acid and phenylalanine. The fragments obtained were studied by modified method of incomplete succinylation which permitted to determine the number of lysine residues, the positive charge and molecular length of polypeptides. The structural homology between the fastest reptilia H1 subfraction and avian H5 histone has been shown.

Amino Acid Sequence↗
PubMedDate not supplied

[Binding of nuclear proteins with segments of the c-fos gene promotor, localized in position (-465)-(-435) correlates with cell proliferation].

Using gel-retardation assay we have investigated binding of nuclear proteins to the mouse c-fos promoter region 30 b.p. long (nucleotides (-464) - (-435) from TATA-box), localized upstream of PDGF-dependent induction element. It was found that some factors from nuclear extracts of various human and murine cells bind to this promoter region. After gel-retardation of DNA- protein complexes from nuclear extracts of quiescent and stimulated with 20% fetal calf serum cells we observed only one retarded band, while after gel-retardation of DNA-protein complexes from proliferating pseudonormal and tumorigenic cells we observed the appearance of additional retarded band with higher mobility in PAAG. We also have determined the molecular weights of factors interacting with investigated c-fos promoter region by affinity modification method. The molecular weights of both factors are 59 kDa. The equality of molecular weights of investigated factors suggests that these factors might be different forms of one nuclear protein.

Animals↗
PubMedDate not supplied

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides].

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

Base Sequence↗
PubMedDate not supplied

[Nuclear peptides, specifically binding oligonucleotides].

Interaction of alkylating derivatives of oligonucleotides with nuclear extracts from mammalian cells has been investigated. Three modified 1.5-, 3.0-, and 6.0-kDa proteins were detected in nuclear extracts from human and murine cells. The 1.5-kDa and 3.0-kDa proteins were also detected in insect, plant, yeast, and bacterial cells. The ubiquity of the proteins suggests their important role in cellular metabolism.

Animals↗