Biomedical subjects

F E Dewhirst

Publications and source records attributed to F E Dewhirst.

At least 19 recordsLinked to original sources

PubMed2001

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Adjuvants, Immunologic↗

PubMed2001

Infection-mediated early-onset periodontal disease in P/E-selectin-deficient mice.

BACKGROUND: Retrospective and correlation studies suggest that early-onset periodontal disease may be due to a deficiency in phagocyte function, a pathogenic oral biofilm, and/or dysregulated gingival cytokine expression. Increased susceptibility to periodontal disease is therefore thought to result from multiple risk factors. METHODS: We tested this hypothesis prospectively using P/E-selectin adhesion molecule deficient mice that mimic the human syndrome leukocyte adhesion deficiency II. RESULTS: Our studies demonstrate that, in comparison to wild type animals, P/E-/- mice exhibit: spontaneous, early onset alveolar bone loss which is significant by 6 weeks of age; a 10-fold elevation in bacterial colonization of their oral cavities; and elevated gingival tissue levels of the bone resorptive cytokine IL-1alpha. Alveolar bone loss is completely prevented by prophylactic antibiotic therapy. CONCLUSIONS: These experiments provide the first prospective evidence for the multiple risk factor hypothesis of periodontal disease, and validate the first animal model for early onset periodontitis in which both the microbiota and host response can be systematically manipulated. P/E-/- animals should be useful in testing the virulence of putative periodontal pathogens, in determining the role of host resistance factors in periodontitis, in exploring the proposed relationship(s) between infection mediated alveolar bone loss and systemic health disorders, and exploring their genetic relationships.

Alveolar Bone Loss↗

PubMed2001

Treponema parvum sp. nov., a small, glucoronic or galacturonic acid-dependent oral spirochaete from lesions of human periodontitis and acute necrotizing ulcerative gingivitis.

Small oral spirochaetes with a strict dependence on either glucuronic acid (GluA) or galacturonic acid (GalA) were isolated from European patients with periodontitis and from Chinese patients with either gingivitis or acute necrotizing ulcerative gingivitis (ANUG). Thirteen such isolates were similar phenotypically to Treponema pectinovorum ATCC 33768T and this classification was confirmed by 16S rRNA sequencing. However, four isolates differed from T. pectinovorum by their small cell size, by a prominent beta-glucuronidase activity, by a distinct protein and antigen profile, by an inability to grow on pectin as sole source of carbohydrate and by a markedly enhanced growth rate when supplied with a second carbohydrate (L-arabinose, D-galactose, D-glucose, D-fructose, D-mannitol, D-mannose, pectin, D-ribose or D-xylose) in addition to the essential GluA/GalA. By 16S rRNA sequencing these four isolates clustered in the recently described phylotype 'Smibert-2'. T. pectinovorum (14 strains) and 'Smibert-2' (four isolates with beta-glucuronidase activity) could each be subdivided into two serotypes based on immunoblot reactivity with two mAbs. Representatives of the two groups, including T. pectinovorum ATCC 33768T, showed a 1:2:1-type periplasmic flagellar arrangement. 'Smibert-2' is described as a novel species, Treponema parvum sp. nov., with isolate OMZ 833T (= ATCC 700770T) proposed as the type strain and OMZ 842 (= ATCC 700773) as reference strain for a second serotype.

Acute Disease↗

PubMed2001

Characterization of novel human oral isolates and cloned 16S rDNA sequences that fall in the family Coriobacteriaceae: description of olsenella gen. nov., reclassification of Lactobacillus uli as Olsenella uli comb. nov. and description of Olsenella profusa sp. nov.

The diversity of organisms present in the subgingival pockets of patients with periodontitis and acute necrotizing ulcerative gingivitis (ANUG) were examined previously. The 16S rRNA genes of subgingival plaque bacteria were amplified using PCR with a universal forward primer and a spirochaete-selective reverse primer. The amplified DNA was cloned into Escherichia coli. In one subject with ANUG, 70 clones were sequenced. Seventy-five per cent of the clones were spirochaetal, as expected. Twelve of the remaining clones fell into two clusters that represent novel phylotypes in the family Coriobacteriaceae. The first novel phylotype was most closely related to Atopobium rimae (98% similarity). The phylotype probably represents a novel Atopobium species, but will not be named until cultivable strains are obtained. The second novel phylotype was only 91% similar to described Atopobium species and 84% similar to Coriobacterium glomerans. The 16S rRNA sequences of the type strain of Lactobacillus uli and a strain representing the Moores' Eubacterium group D52 were determined as part of on ongoing sequence analysis of oral bacteria. The sequence for L. uli was more than 99.8% similar to sequences for the second clone phylotype. It therefore appears that the second clone phylotype and L. uli represent the same species. The sequence for the Eubacterium D52 strain was 95.6% similar to that of L. uli. The G+C content of the DNA of L. uli and Eubacterium D52 is 63-64 mol %. These organisms are thus distinct from the neighbouring genus Atopobium, which has a DNA G+C content of 35-46 mol%. A new genus, Olsenella gen. nov., is proposed for these two species on the basis of phenotypic characteristics and 16S rRNA sequence analysis to include Olsenella uli comb. nov. and Olsenella profusa sp. nov.

Actinobacteria↗

PubMed2001

Evidence that the Campylobacter fetus sap locus is an ancient genomic constituent with origins before mammals and reptiles diverged.

Campylobacter fetus bacteria, isolated from both mammals and reptiles, may be either subsp. fetus or subsp. venerealis and either serotype A or serotype B. Surface layer proteins, expressed and secreted by genes in the sap locus, play an important role in C. fetus virulence. To assess whether the sap locus represents a pathogenicity island and to gain further insights into C. fetus evolution, we examined several C. fetus genes in 18 isolates. All of the isolates had 5 to 9 sapA or sapB homologs. One strain (85-387) possessed both sapA and sapB homologs, suggesting a recombinational event in the sap locus between sapA and sapB strains. When we amplified and analyzed nucleotide sequences from portions of housekeeping gene recA (501 bp) and sapD (450 bp), a part of the 6-kb sap invertible element, the phylogenies of the genes were highly parallel. Among the 15 isolates from mammals, serotype A and serotype B strains generally had consistent positions. The fact that the serotype A C. fetus subsp. fetus and subsp. venerealis strains were on the same branch suggests that their differentiation occurred after the type A-type B split. Isolates from mammals and reptiles formed two distinct tight phylogenetic clusters that were well separated. Sequence analysis of 16S rRNA showed that the reptile strains form a distinct phylotype between mammalian C. fetus and Campylobacter hyointestinalis. The phylogenies and sequence results showing that sapD and recA have similar G + C contents and substitution rates suggest that the sap locus is not a pathogenicity island but rather is an ancient constituent of the C. fetus genome, integral to its biology.

Amino Acid Sequence↗

PubMed2001

Bacterial diversity in human subgingival plaque.

The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our sample of 2,522 clones, we estimate that there are 68 additional unseen species, for a total estimate of 415 species in the subgingival plaque. When organisms found on other oral surfaces such as the cheek, tongue, and teeth are added to this number, the best estimate of the total species diversity in the oral cavity is approximately 500 species, as previously proposed.

Bacteria↗

PubMed2001

Helicobacter typhlonius sp. nov., a Novel Murine Urease-Negative Helicobacter Species.

Over the past decade, several Helicobacter species have been isolated from rodents. With the advent of PCR for the diagnosis of infectious agents, it has become clear that several previously uncharacterized Helicobacter species also colonize rodents. In this report, we describe a novel urease-negative helicobacter, Helicobacter typhlonius sp. nov., which was isolated from colonies of laboratory mice independently by two laboratories. Infection of immunodeficient mice by this bacterium resulted in typhlocolitis similar to that observed with other helicobacter infections. H. typhlonius is genetically most closely related to H. hepaticus. Like H. hepaticus, it is a spiral bacterium with bipolar sheathed flagella. However, this novel species contains a large intervening sequence in its 16S rRNA gene and is biochemically distinct from H. hepaticus. Notably, H. typhlonius does not produce urease or H(2)S nor does it hydrolize indoxyl-acetate. Compared to other Helicobacter species that commonly colonize rodents, H. typhlonius was found to be less prevalent than H. hepaticus and H. rodentium but as prevalent as H. bilis. H. typhlonius joins a growing list of helicobacters that colonize mice and are capable of inducing enteric disease in various strains of immunodeficient mice.

Animals↗

PubMed2001

Isolation of Helicobacter cinaedi from the colon, liver, and mesenteric lymph node of a rhesus monkey with chronic colitis and hepatitis.

On the basis of biochemical, phenotypic, and 16S rRNA analyses, Helicobacter cinaedi was isolated from the colon, liver, and mesenteric lymph nodes of a 2-year-old rhesus monkey with chronic diarrhea. Histologically, the liver had mild to moderate biliary hyperplasia and hypertrophy with periportal inflammation and fibrosis. Colonic and cecal lesions consisted of diffuse chronic inflammation and glandular hyperplasia extending the length of the crypts. This is the first observation of H. cinaedi associated with active hepatitis and colitis in a nonhuman primate.

Animals↗

PubMed2001

Coinfection of enteric Helicobacter spp. and Campylobacter spp. in cats.

During a 6-year period, 64 of 227 commercially reared cats had microaerobic bacteria isolated from their feces. All the isolates were initially identified as Campylobacter-like organisms based on biochemical and phenotypic characteristics. DNA extractions from 51 of these isolates were subjected to PCR using primers specific for Helicobacter spp. and Campylobacter spp. Of the isolates, 92% (47 of 51 isolates) were positive for Campylobacter spp., 41% (21 of 51 isolates) were positive for Helicobacter spp., 33% (17 of 51 isolates) were positive for both genera, 59% (30 of 51 isolates) were positive only for Campylobacter spp., and 8% (4 of 51) were positive only for Helicobacter spp. Sixteen of the 47 Campylobacter-positive cultures were positive for more than one Campylobacter spp. Based on a species-specific PCR assay, 83% of the isolates were identified as Campylobacter helveticus, 47% of the isolates were identified as Campylobacter upsaliensis, and 6% of the isolates were classified as Campylobacter jejuni. The 1.2-kb PCR products of the 16S rRNA genes of 19 Helicobacter species isolates were subjected to restriction fragment length polymorphism (RFLP) analysis. Of the five different RFLP patterns obtained, two clustered with Helicobacter ("Flexispira") taxon 8, one clustered with Helicobacter bilis, one clustered with Helicobacter canis, and the remaining pattern was closely related to a novel Helicobacter sp. strain isolated from a woodchuck. The sequence data for the 16S rRNA genes of 10 Helicobacter spp. validated the RFLP-based identification of these isolates. This study demonstrated that biochemical and phenotypic characteristics of microaerobic organisms in cat feces were insufficient to characterize mixed Helicobacter and Campylobacter infections. Molecular structure-based diagnostics using genus- and species-specific PCR, RFLP analysis, and 16S rRNA sequence analysis enabled the identification of multiple microaerobic species in individual animals. The clinical relevance of enteric Helicobacter and Campylobacter coinfection in cats will require further studies.

Animals↗

PubMed2001

Cholangiohepatitis and inflammatory bowel disease induced by a novel urease-negative Helicobacter species in A/J and Tac:ICR:HascidfRF mice.

Helicobacter bilis and H. hepaticus, both urease-positive intestinal helicobacters of mice, have been shown experimentally to induce proliferative typhlocolitis in scid mice. We recently isolated a urease-negative Helicobacter sp. (H. sp.) that also induced proliferative typhlocolitis in pilot studies in scid mice. To determine the pathogenic potential of H. sp. in immunocompromised and immunocompetent mice, 5-week old male A/J or Tac:Icr:Ha(ICR)-scidfRF mice were inoculated by intraperitoneal (IP) injection with approximately 3 x 10(7) colony-forming units (CFU) of H. sp. Mice were necropsied at various time points postinoculation (PI). Sham-inoculated mice had no clinical, gross, or histopathological lesions. In contrast, scid mice inoculated IP with H. sp. had severe hemorrhagic diarrhea and decreased weight gain at 2, 7, and 18 weeks postinoculation (PI), with severe proliferative typhlocolitis, phlebothrombosis, and hepatitis. A/J mice had no clinical signs, but had mild to moderate proliferative typhlocolitis and moderate to marked cholangiohepatitis at 7 and 24 weeks PI. A/J mice infected with H. sp. developed robust immune responses of a predominant Th1 type. This report demonstrates that infection with a urease-negative helicobacter can cause inflammatory bowel disease (IBD) and hepatitis in scid and immunocompetent A/J mice. These results provide a new model of IBD and cholangio-hepatitis associated with a specific urease-negative, novel H. species.

Animals↗

PubMed2000

The diversity of periodontal spirochetes by 16S rRNA analysis.

The purpose of this study was to examine the diversity of spirochetes in the subgingival pocket of multiple subjects with a range of periodontal conditions, including two healthy, one adult periodontitis, three acute necrotizing ulcerative gingivitis, eight refractory periodontitis, and one human immunodeficiency virus (HIV) periodontitis. The 16S rRNA genes of spirochetes in plaque were amplified by polymerase chain reaction using spirochete selective primers. Over 500 clones were sequenced and subjected to phylogenetic analysis. The sequences clustered into the 10 known cultivated Treponema species and into 47 as-yet-uncultivated Treponema species. Most of these Treponema species were identified from multiple clones and subjects. The human periodontal pocket harbors a highly diverse treponeme population. Of the cultivated species, Treponema denticola, Treponema maltophilum and Treponema sp. Smibert-3 were most commonly encountered in diseased subjects but rarely in healthy subjects. Molecular tools based on the sequence data from this study will allow determination of the prevalence of cultivable and uncultivable treponemes in oral diseases.

Adult↗

PubMed2000

'Flexispira rappini' strains represent at least 10 Helicobacter taxa.

'Flexispira rappini' is a provisional name given to gram-negative, microaerophilic, motile, spindle-shaped micro-organisms with spiral periplasmic fibres and bipolar tufts of sheathed flagella. Several investigators, including Kirkbride, Romero, and Archer isolated strains possessing this morphology. Previously, the phylogenetic position of three 'Flexispira rappini' strains was determined by 165 rRNA sequencing, which indicated that flexispira were members of the genus Helicobacter. As more organisms with 'F. rappini' morphology were isolated, it became apparent that there were multiple Helicobacter taxa with this distinctive morphology. The purpose of this study was to examine a collection of 36 'F. rappini' strains from diverse habitats by using 165 rRNA sequence analysis. The strains fell into 10 taxa, each possibly representing a novel Helicobacter species. Two of these flexispira taxa were previously named, by us, Helicobacter bilis and Helicobacter trogontum. Currently, none of the flexispira taxa contains enough phenotypically and genotypically characterized strains to be formally named 'Helicobacter rappinii'.

Animals↗

PubMed2000

Recommended minimal standards for describing new species of the genus Helicobacter.

The International Committee of Systematic Bacteriology Subcommittee on the taxonomy of Campylobacter and related bacteria has agreed in principle on minimum requirements for the description of new species of the genus Helicobacter. These requirements include the recommendation that the description of a putative new species or subspecies be based on examination of at least five strains in order to provide a measure of phenotypic and genotypic variation. Recommendations for required phenotypic and molecular data are presented. The requirements are consistent with the polyphasic approach to bacterial systematics.

Animals↗

PubMed2000

Isolation and characterization of a Helicobacter sp. from the gastric mucosa of dolphins, Lagenorhynchus acutus and Delphinus delphis.

Gastric ulcerations in dolphins have been reported for decades. Some of these lesions were associated with parasitic infections. However, cases of nonparasitic gastric ulcers with no clearly defined etiology also have been reported in wild and captive dolphins. Considerable speculation exists as to whether dolphins have Helicobacter-associated gastritis and peptic ulcer disease. The stomachs of seven stranded Atlantic white-sided dolphins, Lagenorhynchus acutus, and 1 common dolphin, Delphinus delphis, were assessed for the presence of Helicobacter species. Novel Helicobacter species were identified by culture in the gastric mucosa of two of the eight dolphins studied and by PCR in seven of the eight dolphins. The gram-negative organisms were urease, catalase, and oxidase positive. Spiral to fusiform bacteria were detected in gastric mucosa by Warthin Starry staining. Histopathology revealed mild to moderate diffuse lymphoplasmacytic gastritis within the superficial mucosa of the main stomach. The pyloric stomach was less inflamed, and bacteria did not extend deep into the glands. The lesions parallel those observed in Helicobacter pylori-infected humans. Bacteria from two dolphins classified by 16S rRNA analysis clustered with gastric helicobacters and represent a novel Helicobacter sp. most closely related to H. pylori. These findings suggest that a novel Helicobacter sp. may play a role in the etiopathogenesis of gastritis and gastric ulcers in dolphins. To our knowledge this represents the first isolation and characterization of a novel Helicobacter sp. from a marine mammal and emphasizes the wide host distribution and pathogenic potential of this increasingly important genus.

Animals↗

PubMed2000

Characterization of Porphyromonas gingivalis insertion sequence-like element ISPg5.

Porphyromonas gingivalis, a black-pigmented, gram-negative anaerobe, is found in periodontitis lesions, and its presence in subgingival plaque significantly increases the risk for periodontitis. In contrast to many bacterial pathogens, P. gingivalis strains display considerable variability, which is likely due to genetic exchange and intragenomic changes. To explore the latter possibility, we have studied the occurrence of insertion sequence (IS)-like elements in P. gingivalis W83 by utilizing a convenient and rapid method of capturing IS-like sequences and through analysis of the genome sequence of P. gingivalis strain W83. We adapted the method of Matsutani et al. (S. Matsutani, H. Ohtsubo, Y. Maeda, and E. Ohtsubo, J. Mol. Biol. 196:445-455, 1987) to isolate and clone rapidly annealing DNA sequences characteristic of repetitive regions within a genome. We show that in P. gingivalis strain W83, such sequences include (i) nucleotide sequence with homology to tRNA genes, (ii) a previously described IS element, and (iii) a novel IS-like element. Analysis of the P. gingivalis genome sequence for the distribution of the least used tetranucleotide, CTAG, identified regions in many of the initial 218 contigs which contained CTAG clusters. Examination of these CTAG clusters led to the discovery of 11 copies of the same novel IS-like element identified by the repeated sequence capture method of Matsutani et al. This new 1,512-bp IS-like element, designated ISPg5, has features of the IS3 family of IS elements. When a recombinant plasmid containing much of ISPg5 was used in Southern analysis of several P. gingivalis strains, including clinical isolates, diversity among strains was apparent. This suggests that ISPg5 and other IS elements may contribute to strain diversity and can be used for strain fingerprinting.

Amino Acid Sequence↗

PubMed2000

Helicobacter aurati sp. nov., a urease-positive Helicobacter species cultured from gastrointestinal tissues of Syrian hamsters.

A novel helicobacter with the proposed name Helicobacter aurati (type strain MIT 97-5075c) has been isolated from the inflamed stomachs and ceca of adult Syrian hamsters. The new species is fusiform with multiple bipolar sheathed flagella and periplasmic fibers; it contains urease and gamma-glutamyl transpeptidase. By 16S rRNA sequencing and repetitive element PCR-based DNA fingerprinting, it was found that H. aurati represents a distinct taxon and clusters with Helicobacter muridarum, Helicobacter hepaticus, and Helicobacter sp. MIT 94-022. H. aurati was recovered from hamsters housed in various research and vendor facilities. Further studies are necessary to define its association with disease and other microbiota in hamsters, as well as its impact on research projects involving hamsters. H. aurati (GenBank accession number AF297868) can be used in animal experiments to define the factors that are important for gastric helicobacter pathogenesis.

Animals↗

PubMed2000

Outbreak of nosocomial infections due to extended-spectrum beta-lactamase-producing strains of enteric group 137, a new member of the family Enterobacteriaceae closely related to Citrobacter farmeri and Citrobacter amalonaticus.

A member of the Enterobacteriaceae initially identified as Kluyvera cryocrescens by the MicroScan Gram-Negative Combo 13 panel caused an outbreak of nosocomial infections in four patients (pneumonia, n = 2; urinary tract infection, n = 1; wound infection, n = 1) and urinary tract colonization in one patient. When the strains were tested by the Enteric Reference Laboratory of the Centers for Disease Control and Prevention, biochemical results were most compatible with Yersinia intermedia, Kluyvera cryocrescens, and Citrobacter farmeri but identification scores were low and test results were discrepant. However, when the biochemical test profile was placed in the computer database as a new organism, all strains were identified as the organism with high identification scores (0. 999968 to 0.999997) and no discrepant test results. By 16S rRNA sequence analysis the organism clustered most closely with, but was distinct from, Citrobacter farmeri and Citrobacter amalonaticus. Based on its unique biochemical profile and rRNA sequence, this organism is designated Enteric Group 137. Restriction endonuclease analysis and taxonomic antibiograms of strains causing the outbreak demonstrated a single clone of Enteric Group 137, and antibiotic susceptibility testing revealed the presence of extended-spectrum beta-lactamase (ESBL) resistance. Enteric Group 137 appears to be a new opportunistic pathogen that can serve as a source of ESBL resistance in the hospital.

Aged↗

PubMed2000

Helicobacter canadensis sp. nov. isolated from humans with diarrhea as an example of an emerging pathogen.

We recently analyzed 11 helicobacter isolates cultured from diarrhea patients in Canada. These isolates had been characterized biochemically by restriction fragment length polymorphism (RFLP; AluI, HhaI) analysis and by fatty-acid analysis as Helicobacter pullorum. However, four of the isolates differed biochemically from H. pullorum by their inability to hydrolyze indoxyl acetate and their resistance to nalidixic acid. Using complete 16S rRNA analysis, we determined that these four strains clustered near H. pullorum but had a sequence difference of 2% and therefore represent a novel helicobacter, Helicobacter canadensis. This novel helicobacter could also be distinguished from H. pullorum by RFLP analysis using ApaLI. The number of novel Helicobacter spp. associated with gastrointestinal disease in humans and animals is rapidly increasing. There are now six Helicobacter spp. isolated from diarrheic humans, the other five being H. pullorum, H. canis, "H. rappini," H. fennelliae, and H. cinaedi. This finding highlights the importance of careful molecular analysis in addition to standard biochemical tests in identifying the increasing number of Helicobacter spp. isolated from humans and animals.

Bacterial Typing Techniques↗