Search PubMed⌕ Search

Biomedical subjects

F C Davis

Publications and source records attributed to F C Davis.

At least 37 records · Page 2Linked to original sources
PubMed1993

Developmental appearance and age related changes in specific 2-[125I]iodomelatonin binding sites in the suprachiasmatic nuclei of female Syrian hamsters.

In Syrian hamsters, the circadian timing system is sensitive to melatonin during gestation but is not responsive in the adult. In order to further understand this developmental change in melatonin responsiveness, in vitro autoradiography was used to assess the presence of specific 2-[125I]iodomelatonin binding sites in the suprachiasmatic nuclei of female hamsters of selected embryonic (E) and postnatal (PN) ages (e.g. E13, E14, E15, PN1, PN2, PN12, PN25, PN112-133). Specific 2-[125I]iodomelatonin binding sites were seen in the suprachiasmatic nuclei of some of the E14 hamsters and all the perinatal hamsters (E15, PN1 and PN2) but not in older hamsters. In contrast, specific 2-[125I]iodomelatonin binding sites were seen in the pars tuberalis of all hamsters (with the exception of one), regardless of age. The transient expression of specific 2-[125I]iodomelatonin binding sites in the suprachiasmatic nuclei suggests that melatonin may have some special functions restricted to early development. The specific 2-[125I]iodomelatonin binding sites in the embryonic suprachiasmatic nuclei may represent the substrate for maternal melatonin to set the phase of the developing circadian timing system.

Aging↗
PubMed1993

The fetal circadian pacemaker is not involved in the timing of birth in hamsters.

The role of the fetal circadian pacemaker in the timing of birth was examined in Syrian hamsters (Mesocricetus auratus). Two groups of pregnant hamsters with lesions of the suprachiasmatic nucleus received daily intraperitoneal injections of melatonin (25 micrograms) on Days 9-15 of gestation. One group was injected with melatonin in the evening and the other in the morning. After the last set of injections, the animals were observed every hour until they gave birth. The timing of birth was not significantly different in the two groups, indicating that it was not affected by the melatonin injections. In contrast, the average phases of the pups' activity rhythms at weaning were significantly different in the two groups; this difference, approximately 10 h, indicated that the prenatal melatonin injections set the phases of the pups' circadian pacemakers. These results suggest that the fetal pacemaker is not involved in the timing of birth, since the pacemaker could be set to different phases without affecting this timing. In a separate study, time of birth and length of gestation were measured for heterozygous tau mutant pups, which express a circadian rhythm with a period of approximately 22 h. The results were compared with similar measurements obtained from a previous study of wild-type pups that express a circadian rhythm with a period of approximately 24 h. In both cases, the pups had been born to wild-type mothers. The timing of birth was similar in the two groups, indicating that the tau mutation does not influence the length of gestation or the time of day when birth occurs.

Animals↗
PubMed1992

Timing of birth in Syrian hamsters.

The effects of mating time and of LD cycles on the timing of birth and length of gestation were examined in Syrian hamsters (Mesocricetus auratus). Hamsters maintained on 14L:10D cycles were mated for 2 h either in the evening or in the morning, and groups of hamsters mated in the morning were subjected to either a 6-h advance shift or a 6-h delay shift of the LD cycle on Days 5-14 of gestation. For the last 2 days of gestation the hamsters were kept in constant dim light and observed every hour to determine the time of birth. Hamsters mated in the evening gave birth an average of 4.8 h before those mated in the morning, and the hamsters subjected to an advance shift gave birth an average of 8.1 h before those subjected to delay shift. The results show that 80-100% of births occur during the subjective day on Day 16 of gestation and that the minimum duration of gestation is 15 days and 2 h. The regulation of birth appears to involve two processes, an interval timer related to the time of conception and a circadian rhythm that is governed by the LD cycle.

Animals↗
PubMed1992

Maternal entrainment of tau mutant hamsters.

Maternal entrainment of the circadian wheel-running activity rhythm was examined in Syrian hamsters heterozygous for a single gene mutation (tau) that affects the free-running period of circadian rhythms. Heterozygous tau pups were born to and raised by wild-type mothers under constant dim light. The pups' wheel-running activity was recorded after weaning on postnatal day 18 or 24. Pups weaned on day 18 had an average free-running period of 21.70 hr, demonstrating that the tau phenotype was fully expressed at this age. Using the activity onset of the postnatal free-running rhythms as a phase reference, we estimated the phase relationships between the pups and their mothers on days 18 and 24. In contrast to results with wild-type pups, the activity rhythms of tau pups were not in phase with the rhythms of their wild-type mothers; that is, activity onsets of mothers and pups did not coincide. The pups did, however, show synchrony among themselves, indicating that they had been exposed to a synchronizing signal sometime during development. It is likely that this synchronizing signal was provided by the mothers, since pups from different litters showed phase relationships similar to those of their mothers. Thus the mothers provided a signal that was sufficient to cause entrainment, despite the 2-hr difference in free-running period between the mothers and pups. Although the pups' activity rhythms appeared to have been entrained by the mothers, they were clearly free-running by postnatal day 18. The mechanism for entrainment is lost during the course of development, despite continued interaction between the mothers and pups.

Animals↗
PubMed1992

Nucleotide sequence of the Urechis caupo core histone gene tandem repeat.

The 4942 bp nucleotide sequence of a repeating unit from the core histone gene tandem repeat of Urechis caupo and the predicted amino acid sequence of the four core histones are presented. Putative promoter elements including the CAP site and TATA box as well as multiple CAAT-like sequences are identified upstream from each gene. Upstream from each core histone gene are 26 or 30 bp sequences that may have a promoter function and appear to be unique to Urechis histone genes. Located 5' to both H2A and H2B is the 26 bp sequence, GGTCATGTGACTCTAATACCGCGCTG. An identical, but inverted, 26 bp sequence is present upstream of H4. Upstream from the H3 gene, two regions of a 30 bp sequence, GGTCTTGTGGCGGGAACAAATACCGCAACG, are very similar to corresponding regions of the 26 bp sequence. Additional 10 bp conserved sequences, CAGCGGGCGC, are present only upstream from the H2A and H2B genes. Conserved sequences containing a region of dyad symmetry followed by a purine-rich sequence that are typical of histone mRNA termination sites are present 27 to 36 bp 3' from the termination codon. Short repetitive DNA sequence elements are present in the spacer sequences between the H2A and H3 genes and the H2B and H4 gene.

Amino Acid Sequence↗
PubMed1990

Neurogenesis of the hamster suprachiasmatic nucleus.

Neurogenesis of the hypothalamic suprachiasmatic nucleus (SCN) was described in the Syrian hamster (Mesocricetus auratus) using tritiated [3H]thymidine autoradiography. Pregnant hamsters were given single intraperitoneal injections of [3H]thymidine at different times during prenatal development, and labeled cells were analyzed in the offspring of 4-5 weeks of age. Cells of the hamster SCN became postmitotic (were 'born') over two and a half days from 10.5 to 13.0 days postfertilization (dpf) with a peak around 11.5 dpf, 4 days before birth. Two gradients in SCN neurogenesis were observed. Posterior cells were produced somewhat earlier than anterior cells and ventrolateral cells were produced before dorsomedial cells. An exception to the second gradient was a small population of ventrolateral cells produced near the end of SCN neurogenesis. The pattern of SCN neurogenesis in the hamster was similar to that described in the rat, including a predominant ventrolateral to dorsomedial gradient and the presence of ventral or ventrolateral cells produced relatively late, contrary to the predominant gradient.

Aging↗
PubMed1990

Transplanted suprachiasmatic nucleus determines circadian period.

The pacemaker role of the suprachiasmatic nucleus in a mammalian circadian system was tested by neural transplantation by using a mutant strain of hamster that shows a short circadian period. Small neural grafts from the suprachiasmatic region restored circadian rhythms to arrhythmic animals whose own nucleus had been ablated. The restored rhythms always exhibited the period of the donor genotype regardless of the direction of the transplant or genotype of the host. The basic period of the overt circadian rhythm therefore is determined by cells of the suprachiasmatic region.

Animals↗
PubMed1990

Recent studies on the biological actions of vitamin D on intestinal transport and the electrophysiology of peripheral nerve and cardiac muscle.

Vitamin D, with parathyroid hormone and calcitonin, is an essential factor in the homeostatic regulation of systemic calcium in most vertebrate species. Targets for this aspect of vitamin D action, through its biologically active metabolites, are primarily the intestine, kidney and bone. Each of these tissues or organs are stimulated by 1,25(OH)2D3 to increase the transport calcium into the extracellular fluid compartment when plasma calcium levels are below normal and/or when there is a greater need for calcium to meet the requirements of physiological processes, such as growth, gestation and lactation. During such periods, the efficiency of the absorption of calcium from the intestine increases, the resorption of calcium salts from bone is stimulated, and the efficiency of the reabsorption of filtered calcium by the renal tubule is increased. In addition to the homeostatic function of vitamin D, there is an increasing amount of evidence that vitamin D has important effects on tissues and organs other than those concerned with calcium homeostasis. With regard to the intestinal epithelial system, the genomic effect of 1,25(OH)2D3 was shown several years ago when the de novo synthesis of a specific vitamin D-induced calcium-binding protein (CaBP, calbindin-D) was demonstrated. In our view, this appears to be an essential factor in the well-documented enhancement of calcium absorption by vitamin D. The function of calbindin-D, a high affinity calcium-binding protein, in the absorptive process is not precisely known but currently considered to act as an intracellular facilitator of the diffusion of calcium from the microvillar pole of the enterocyte to the basal-lateral membrane. There is evidence that vitamin D influences another step in the absorptive process. This step appears to be associated with the entrance of luminal calcium into the enterocyte, the first step in the transepithelial transport process. This response appears to occur relatively early (1 h or less) after 1,25(OH)2D3 is given to vitamin D-deficient animals, whereas the de novo synthesis of transport proteins has a much longer lag time (about 4 h). The in vitro absorption studies of Nemere et al (1984) and the in vivo experiments of our group (Wasserman et al, 1982) accentuate this point. However, the more rapid reaction, i.e., the possible modification of the permeability properties of the brush border membrane, does not result in a substantive increase in overall calcium absorption unless the enterocyte had been "primed" by previous exposure to vitamin D. The "priming" reaction might represent the synthesis of CaBP or some other intracellular component.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1989

Daily variation in maternal and fetal weight gain in mice and hamsters.

Daily variation in maternal and fetal weight gain was measured in hamsters (Mesocricetus auratus) and in mice (Mus musculus, C57Bl) with free access to food or under restricted feeding schedules. Pregnant hamsters with free access to food and water were weighed twice a day and fetuses were collected twice a day from 10.5 to 14.5 days after fertilization. In three experiments, pregnant mice were given free access to food and water or were allowed food for 12 hours a day or for 6 hours a day. Pregnant mice were weighed twice a day and in the restricted feeding experiments, fetuses were collected every 6 hours from 12.0 to 14.5 days after fertilization. Pregnant mice and hamsters with free access to food showed a daily rhythm in weight gain with greater gain at night. There was no evidence of a daily rhythm in the weight gain with greater gain at night. There was no evidence of a daily rhythm in the weight gain of hamster fetuses. Mouse fetuses showed greater weight gain during two 6-hour intervals each day, the second half of each night and the second half of each day. The 12-hour variation was seen in both wet and dry fetal weight. A 24-hour rhythm in fetal growth was previously described in rats (Barr: Teratology, 7:283-288, 1973). Results in rats and mice indicate that fetal growth is modulated on a daily basis. The different periodicity observed in rats and mice might be related to the different ages of the fetuses examined.

Animals↗
PubMed1989

The tobacco withdrawal syndrome: performance decrements assessed on a computerized test battery.

The effects of tobacco abstinence and resumption of smoking on cognitive performance were studied in seven cigarette smokers. Subjects were trained on a computerized performance assessment battery (PAB) that included five different tests. Baseline data were obtained under conditions of minimally restricted cigarette smoking. This baseline smoking phase ended at 1000 h on the first day of tobacco deprivation and the PAB was then administered at intervals of 1, 4 and 8 h, and once at 1000 h on each of the next 9 days. Upon resumption of smoking (1000 h on day 11), testing was conducted at intervals of 1, 4, 8 and 24 h. The main findings were that tobacco deprivation resulted in significantly increased response latencies on all of the tests and decreased accuracy on two tests. Some performance impairments were observed within 4 h after the start of the smoke deprivation phase. Impairments peaked at 24-48 h and then begun to return toward baseline values; however, some measures remained significantly changed throughout the 10 days of abstinence. Performance decrements that were still evident throughout the deprivation phase were at least partially reversed after 1 h of resumption of smoking; all values returned to baseline levels within 24 h of resumption of smoking.

Adult↗
PubMed1988

Development of hamster circadian rhythms: role of the maternal suprachiasmatic nucleus.

During development, the circadian rhythms of rodents become entrained to rhythmicity of the mother. Rhythms in behavior and in neuroendocrine function are regulated by a circadian pacemaker thought to be located within the suprachiasmatic nucleus (SCN) of the hypothalamus. Evidence indicates that this pacemaker begins to function and to be entrained by maternal rhythms before birth. Although the maternal rhythms which mediate prenatal entrainment of the fetal circadian pacemaker have not been identified, it is likely that they are regulated by the maternal SCN. The role of the maternal SCN in entrainment of the offspring was examined in Syrian hamsters (Mesocricetus auratus) by measuring the activity/rest rhythms of pups. Using the synchrony among the rhythms of pups within a litter as an indication that the pups had been entrained, the effect on entrainment of ablating the maternal SCN was determined. Lesions of the maternal SCN which were performed early in gestation (day 7) and which destroyed at least 75% of the SCN were found to disrupt the normal within litter synchrony among pups, indicating interference with the normal mechanism of entrainment. The effect of lesions on day 7 of gestation could mean that the maternal SCN is important for entrainment of the pups before birth, after birth, or during both of these times. To determine if the maternal SCN is specifically important for prenatal entrainment, lesions were performed two days before birth on day 14 of gestation. Lesions of the maternal SCN on day 14 were not as disruptive as were lesions on day 7. This suggests that the maternal SCN is important between days 7 and 14 of gestation and that the synchrony normally observed at weaning is already established, in part, on or before day 14 of gestation. This further suggests that an entrainable circadian pacemaker is present in the fetus only two weeks after fertilization.

Aging↗
PubMed1988

Cloning and characterization of a core histone gene tandem repeat in Urechis caupo.

A Urechis caupo histone gene tandem repeat has been isolated from a 5.0-kilobase EcoRI genomic library in lambda gtWES.lambda B. Genomic reconstruction experiments indicate that the cloned sequence is repeated approximately 100 times per haploid genome. Unique restriction fragments from the cloned sequence hybridize with individual core histone genes from a histone gene tandem repeat of the sea urchin, Strongylocentrotus purpuratus. No hybridization is detected when restriction digests are probed with a sea urchin H1 histone gene. Hybrid selection and in vitro translation of embryo mRNAs demonstrate that the clone contains sequences complementary to all four core histones; however, no H1 histone is detected among the translation products. Based on a restriction site map of the clone and the subcloned sequences which hybridize to the histone mRNAs, the order of the core histone genes in the clone is shown to be H3 H2A H2B H4. S1 nuclease hybrid protection mapping is used to locate the coding regions and to determine the transcript lengths of the core histone mRNAs. The transcript lengths of H2A, H2B, H3, and H4 mRNAs are approximately 464, 438, 494, and 397 bases, respectively. The S1 nuclease mapping also demonstrates that H2A and H4 are transcribed from one DNA strand while H2B and H3 are transcribed from the other strand. In the tandem repeat, the genes are organized so that transcription of the H2A-H2B and H3-H4 gene pairs is divergent.

Animals↗
PubMed1988

Entrainment of hamster pup circadian rhythms by prenatal melatonin injections to the mother.

A circadian pacemaker, thought to be within the suprachiasmatic nucleus (SCN) of the hypothalamus, begins to function before birth in rodents. Prenatal entrainment of the pacemaker appears to be mediated by signals regulated by the maternal SCN; ablation of the mother's SCN during gestation disrupts the normal phase of the pups' rhythms. The present paper presents an experimental approach for identifying candidate entraining signals and for testing when they are effective during development. The candidate signal examined in these experiments was the pineal gland hormone, melatonin. Female golden hamsters (Mesocricetus auratus) received SCN lesions on day 7 of gestation. During the last week of gestation, they were given two daily subcutaneous injections of oil 12 h apart. One of the injections each day contained melatonin (10, 50, or 100 micrograms). The phases of the pups' activity rhythms were measured at weaning and were found to be related to the timing of the daily injection that contained melatonin, demonstrating that the melatonin directly or indirectly set the phase of the pups' rhythms. Injections given over 4 days of gestation were found to be as effective as injections given over 7 days. Although a physiological role for melatonin as an entraining signal has not been demonstrated, the results show that exogenous, prenatal treatment can predictably set the phase of the offsprings' circadian rhythms.

Animals↗
PubMed1987

Activity and reproductive state in the hamster: independent control by social stimuli and a circadian pacemaker.

Entrainment of circadian rhythms by social communication between male and female Syrian hamsters (Mesocricetus auratus) was tested by recording the wheel-running activity of pairs kept in the same cage but separated by a wire mesh barrier. Before pairing, males and females were synchronized to light/dark cycles that were 180 degrees out of phase, and at the time of pairing the hamsters were placed into constant darkness (DD). The activity rhythms of males and females housed in a cage alone (isolated) were also recorded. The freerunning periods of paired and isolated hamsters were not different over six weeks in DD, and no phase-shifts of the paired animals' rhythms were seen, indicating that the close proximity of a hamster of the opposite sex had no effect on the timing of the other's activity/rest rhythm. This was not due to a lack of communication between the paired males and females. Males showed four-day cycles in the amount and distribution of activity which corresponded to the estrous cycle of the female, and regression of the reproductive system which occurred in the isolated hamsters was delayed in both the paired males and females. Despite the fact that locomotor activity and reproduction are each regulated in part by a circadian pacemaker, social stimuli can affect both of these without influencing the circadian pacemaker that underlies the activity/rest rhythm.

Animals↗
PubMed1985

Histone messenger RNA synthesis and accumulation during early development in the echiuroid worm, Urechis caupo.

RNA isolated from Urechis caupo mature oocytes and embryos was analyzed for the presence of histone messenger RNAs (mRNAs) by in vitro translation and by filter blot hybridization to determine the contribution of maternal and newly transcribed histone mRNAs to the pattern of histone synthesis during early development. Histone mRNAs were not detected in mature oocyte RNA which suggests that relatively few if any maternal histone mRNAs are sequestered in the mature oocytes. Histone mRNAs were detected in cleavage-stage RNA and increased in amount from midcleavage through late gastrula stages. The in vitro translation analysis also demonstrated that the amount of H1 histone mRNA in late cleavage- and early blastula-stage embryos exceeds that of the individual core histone mRNAs. The disproportionate accumulation of individual histone mRNAs correlates with the noncoordinate synthesis of H1 and core histones which occurs during early embryogenesis.

Animals↗
PubMed1985

Formation of the sexually dimorphic nucleus of the preoptic area: neuronal growth, migration and changes in cell number.

The sexually dimorphic nucleus of the preoptic area (SDN-POA) appears to be a morphological marker of the process of sexual differentiation of the rat brain. A portion of the presumptive SDN-POA neurons can be specifically identified utilizing autoradiography following the administration of [3H]thymidine on day 18 of gestation. In the present study we have utilized this fact in order to describe the general pattern of formation of the SDN-POA during the perinatal period. Following the administration of [3H]thymidine, fetal pups were sacrificed and perfused with neutral formalin either two hours after the injection or on day 20 or 22 postfertilization. Neonatal pups were either sacrificed and perfused or assigned to one of the treatment groups. Male pups were either gonadectomized or sham gonadectomized; females were all sham gonadectomized. These pups were then sacrificed and perfused on either day 26, 28 or 32 postfertilization. All brains were processed for autoradiography. The size, number and location of labeled cells within the medial preoptic area (MPOA) was determined. In general it appears that the labeled cells grow in size during the early postnatal period. These cells also migrate from the more ventral aspects of the MPOA to aggregate and form the SDN-POA. Furthermore, there is a significant decrease in the number of labeled cells by day 32 postfertilization (day 10 of postnatal life) which appears to contribute to the specific labeling of the SDN-POA of the adult animal. However, results obtained in this study from quantitative analyses do not indicate that sex or the postnatal steroid hormone environment influence the processes of growth, migration and decrease in MPOA cell number of those presumptive SDN-POA cells born specifically on day 18 of gestation and analyzed in this study.

Animals↗
PubMed1985

Development of hamster circadian rhythms. I. Within-litter synchrony of mother and pup activity rhythms at weaning.

The circadian wheel-running activity rhythms of individual hamster pups raised and maintained in constant dim light were measured beginning at 18 days of age. Records of the postweaning free-running activity rhythm were used to determine the phase of a pup's rhythm on the day of weaning and its phase relationship to its mother's rhythm. Although raised in constant light, the rhythms of pups within a litter were approximately synchronous and in phase with their mother's activity rhythm. These results indicate that the circadian oscillator underlying the activity rhythm is functional prior to weaning and is entrained by some as yet unidentified aspect of maternal rhythmicity. Furthermore, the results suggest that even in the absence of external entraining cycles, behavioral rhythms, and perhaps physiologic rhythms as well, of a mother and her offspring are normally synchronized.

Animals↗