Search PubMed⌕ Search

Biomedical subjects

Eric Henderson

Publications and source records attributed to Eric Henderson.

11 recordsLinked to original sources

Detection and quantification of protein biomarkers from fewer than 10 cells.

The use of antibody microarrays continues to grow rapidly due to the recent advances in proteomics and automation and the opportunity this combination creates for high throughput multiplexed analysis of protein biomarkers. However, a primary limitation of this technology is the lack of PCR-like amplification methods for proteins. Therefore, to realize the full potential of array-based protein biomarker screening it is necessary to construct assays that can detect and quantify protein biomarkers with very high sensitivity, in the femtomolar range, and from limited sample quantities. We describe here the construction of ultramicroarrays, combining the advantages of microarraying including multiplexing capabilities, higher throughput, and cost savings with the ability to screen very small sample volumes. Antibody ultramicroarrays for the detection of interleukin-6 and prostate-specific antigen (PSA), a widely used biomarker for prostate cancer screening, were constructed. These ultramicroarrays were found to have a high specificity and sensitivity with detection levels using purified proteins in the attomole range. Using these ultramicroarrays, we were able to detect PSA secreted from 100 LNCaP cells in 3 h and from just four LNCaP cells in 24 h. Cellular PSA could also be detected from the lysate of an average of just six cells. This strategy should enable proteomic analysis of materials that are available in very limited quantities such as those collected by laser capture microdissection, neonatal biopsy microspecimens, and forensic samples.

Biomarkers↗

Analysis of solid-phase immobilized antibodies by atomic force microscopy.

Antibody adsorption to solid surfaces creates a number of constraints that may interfere with epitope recognition and ligand-antibody interaction. By optimizing the conditions of adsorption, one may minimize these constraints. We have studied several factors that affect the antibody adsorption using atomic force microscopy (AFM) as a readout mechanism. AFM provides a highly sensitive, label-free method for detecting and analyzing molecular interactions. In this report, AFM was used to study antibody properties, the efficiency of particle capture and ligand-antibody interaction using anti-bacteriophage fd antibodies in a solid phase assay format. The capture efficiencies of anti-fd preparations adsorbed onto gold surfaces under various conditions including pH and antibody concentration were determined and compared. The relative sensitivities of each antibody for the capture of phage fd as a function of applied phage concentrations was evaluated. The collective data indicates that AFM is effective as an analytical instrument for studying the functionality of surface adsorbed antibodies in particle capture assays. This method of analysis can be extended to rapidly screen and select antibodies or other ligands with a specific set of characteristics. As the number and complexity of chip-based analytical platforms in proteomics increases, rapid selection/screening processes such as that described here will become invaluable.

Animals↗

Functional protein nanoarrays for biomarker profiling.

The use of microarrays for parallel screening of nucleic acid profiles has become an industry standard. Similar efforts for screening protein-protein interactions are gaining momentum, however, they remain limited by the requirement for relatively large sample volumes. One strategy for overcoming this problem is to significantly decrease the size and consequently the sample volume of the protein interaction assay. We report here on our progress over the last two years in the construction of ultraminiaturized, functional protein capture assays. Each one micron spot in these array-based assays covers less than 1/1000(th) of the surface area of a conventional microarray spot while still maintaining enough antibodies to provide a useful dynamic range. These nanoarray assays can be read by conventional optical fluorescence microscopy as well as by novel label-free methods such as atomic force microscopy. The size reduction realized by functional protein nanoarrays also creates opportunities for novel applications including highly multiplexed single cell analysis and integration with microfluidics and other "lab-on-a-chip" technologies.

Biomarkers↗

Microfabricated quill-type surface patterning tools for the creation of biological micro/nano arrays.

Novel quill-type cantilever-based surface patterning tools (SPTs) were designed and constructed for use in controlled placement of femtoliter volumes of biological molecules on surfaces for biological applications. These tools were fabricated from silicon dioxide using microelectromechanical systems (MEMS) techniques. They featured a 1 microm split gap, fluidic transport microchannels and self-replenishing reservoirs. Experimental trials were performed using these tools on NanoArrayer molecular deposition instrumentation. Cy3-streptavidin was loaded as a biological sample and patterned on an amine-reactive dithiobis-succinimidyl undecanoate (DSU) monolayer on gold. Results showed these tools were capable of generating high quality biological arrays with routine spot sizes of 2-3 microm. The spot size could potentially achieve sub-micron dimensions if these SPT designs are reduced in size by more precise microfabrication techniques. The geometric designs of these tools facilitated sample replenishment from the local reservoir on the cantilever which allowed printing of large numbers of spots without sample reloading.

Adsorption↗

Label-free protein and pathogen detection using the atomic force microscope.

The atomic force microscope (AFM) uses a sharp micron-scale tip to scan and amplify surface features, providing exceptionally detailed topographical information with magnification on the order of x10(6). This instrument is used extensively for quality control in the computer and semiconductor industries and is becoming a progressively more important tool in the biological sciences. Advantages of the AFM for biological application include the ability to obtain information in a direct, label-free manner and the ability to image in solution, providing real-time data acquisition under physiologically relevant conditions. A novel application of the AFM currently under development combines its surface profiling capabilities with fixed immuno-capture using antibodies immobilized in a nanoarray format. This provides a distinctive platform for direct, label-free detection and characterization of viral particles and other pathogens.

Animals↗

Virus particle detection by solid phase immunocapture and atomic force microscopy.

A novel application of atomic force microscopy (AFM) in the rapid, label-free detection and identification of viruses is described. Multiplexed, miniaturized antibody domains were constructed using "ink-jet" protein arraying technology. The solid-phase affinity substrate termed the "ViriChip" was used in the immunocapture of bacteriophage fd, canine parvoviruses, and coxsackieviruses and analyzed by AFM. Immunocapture was found to be antibody-specific with a sensitivity of 10(8)pfu/ml in 30min. Virus binding was found to be linear for concentration between 10(8) and 10(10)pfu/ml and did not reach saturation through 4h.

Equipment Design↗

Identification of non-telomeric G4-DNA binding proteins in human, E. coli, yeast, and Arabidopsis.

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.

Arabidopsis↗

Characterization of testudine melanomacrophage linear, membrane extension processes--cablepodia--by phase and atomic force microscopy.

Melanomacrophages (MMs) are a component of an internal, pigmented cell system in liver and splenic tissues of some fishes, anurans, and reptiles. The cells have been found in centers or aggregates in sinusoids and are associated with cells capable of producing a peptide cytokine and immunoglobulins. A unique cell extension process has been observed in turtle MMs placed into cell culture, and this process has been studied by light and atomic force microscopy. These structures, referred to as cablepodia, are uniquely straight, narrow, and unbranching and appear to originate from growth cones opposite lamellipodia. Cablepodia were found to connect with other turtle MMs and fibroblasts forming cell networks. Dividing fibroblasts to which a cablepodium attached ceased cell division. The observations collectively suggest that a principal reason for aggregations of MMs in internal organs of lower vertebrates is their ability to form interconnected networks of cell processes for trapping and processing of particulate matter, cells, and infectious organisms and, possibly, for the communication of cell signals and transfer of intracellular materials.

Animals↗