Search PubMed⌕ Search

Biomedical subjects

E S Severin

Publications and source records attributed to E S Severin.

At least 19 recordsLinked to original sources
PubMed2003

Tumor angiogenesis inhibitors.

Formation of the blood supply system is a critical step in malignant transformation of neoplasms which results in the penetration of tumor cells into neighboring tissues and metastatic growth. Significant progress in the elucidation of mechanisms underlying tumor angiogenesis and the discovery of a great diversity of biomolecules involved in its regulation have culminated in the development of a radically new approach to antitumor therapy based on the search for efficient inhibitors of tumor angiogenesis. This review is devoted to the analysis of action mechanisms and expression of the major endogenous inhibitors involved in regulation of tumor and physiological angiogenesis. The antiangiogenic effects of the majority of currently known synthetic inhibitors are considered in the context of their roles in the main steps of tumor angiogenesis. Possible applications of antiangiogenic therapy in the chemotherapy of cancer diseases are discussed.

Angiogenesis Inhibitors↗
PubMed2002

Protein kinase A: regulation and receptor-mediated delivery of antisense oligonucleotides and cytotoxic drugs.

Protein kinases help regulate eukaryotic cell division. We investigated the regulation of cAMP-dependent protein kinase A (PKA) and casein kinase (CK) type I activity in normal cells and in cancer. To assess this activity in biopsies we suggest a new parameter--the ratio of CK activity and total PKA activity divided by cAMP concentration: CK/PKA/cAMP. In 98 samples of colon mucosa in normal, inflamed, polyp, and adenocarcinoma cells, we found this parameter to be fairly constant in normal conditions and increased 10-fold in colon cancer; the ratio does not depend on the place of biopsy or the patient's age or sex. Experiments with model systems of concanavalin A-stimulated lymphocytes and regenerating rat liver showed that in normal cell proliferation the parameter increases 2-3-fold, as compared to a 30-fold increase in cancer. Unlike normal cells, malignant cells show CK activation and decrease of cAMP; therefore, PKA activity decreases. This suggests a correlation of CK and PKA activity and significant damage to their regulation at pathological changes of tissue proliferation. To further study concerted CK and PKA regulation we used monoclonal antibodies (mAbs) against cAMP-dependent protein kinase regulatory subunit RKII beta. We produced 11 antibodies in three groups: inhibiting, which block cAMP binding with RII beta and inhibit holoenzyme formation (RS6); activating, which enhance cAMP binding and do not affect holoenzyme formation (RS28); and neutral (RS17). To investigate mAb influence on protein kinase regulation in live cells we permeabilized pheochromocytoma PC12 by digitonin. When used at 5-microM concentration for 5 min, digitonin allowed us to deliver mAb into PC12 cells at 30-34-nM concentration, leaving 68-75% viable cells. Protein kinase activity was measured within 0.5 and 4 h after incorporation of mAbs into cells. After 30 min incorporation, mAb RS6 blocked PKA activation in PC12 cells under the influence of cAMP; other mAbs showed no effect. mAb RS6 caused a 4-fold increase of free C subunit activity 4 h after incorporation. mAb RS38 decreased R2C2 activity and did not influence C subunit activity. The change of free C subunit activity caused by mAb incorporation was followed by a synchronized, well-balanced change of CK type I activity, which suggests a correlation between the two phosphorylation systems of cell proteins.

Adenocarcinoma↗
PubMed1999

Water-soluble 2,3,7,8-tetrachlorodibenzo-p-dioxin complex with human alpha-fetoprotein: properties, toxicity in vivo and antitumor activity in vitro.

The conditions for the formation of a non-covalent complex between 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and the human transport fetal protein, alpha-fetoprotein (AFP), have been studied. TCDD has been shown to form a stable complex with AFP in a 2:1 (TCDD:AFP) ratio. The apparent solubility of TCDD in water increases 10(5)-fold after complex formation. The toxicity of the TCDD:AFP complex injected into mice by the intravenous route is comparable with that of free TCDD administered in oil solution per os. The complex manifests very much higher toxicity (200-1400 times) against human tumor cells (CEM, MCF-7, HepG2) in vitro and surpasses TCDD in selectivity. AFP may facilitate TCDD transport in embryonic tissues and enhance its embryotoxic and teratogenic effects.

Animals↗
PubMed1999

["Prostatic" kallikreins, sex hormones and insulin-like growth factors: complex of male and female regulatory elements in health and carcinogenesis].

Publications (up to the year 1997) on the interactions of "prostatic" kallikreins (prostatic specific antigen-PSA, etc.), sex hormones, insulin-like growth factors (IGF) and proteins binding them (IGFBP) in physiological processes (ageing, menstrual cycle, pregnancy) and oncogenesis (prostatic and mammary cancer) are reviewed. The concentrations of PSA, IGF, and IGFBP in organs and liquid media of men and women are presented. A concept of similarity in the mechanisms of interactions of sex hormones (dihydrotestosterone in men and progesterone in women), PSA, IGFBP, and IGF during activation of anabolic and proliferative processes in health and carcinogenesis is presented as a scheme. The diagnostic and prognostic value of PSA as a cancer marker should not be confined to male tumors (prostatic cancer and benign prostatic hyperplasia). Our data permits us to regard PSA as an oncofetal marker for men and women, indicating normal and neoplastic proliferative processes in the prostatic, mammary, salivary, and other glands and in the lungs and endometrium. Diagnostic and prognostic significance of PSA in breast cancer is shown. The traditional name "PSA" does not reflect its physiological and pathogenetic role as a member of the kallikrein family with chymotrypsin-like activity. PSA is not absolutely specific towards the producer organ and sex. Its relative specificity for the prostate is undoubted, because the content of PSA in prostatic tissue and seminal plasma is 10(6)-10(8) times higher than in the serum and other organs of men and women. Therefore, although the terms "prostatic, "specific", and "antigen" now became trivial and it is difficult to refuse from them, they can be used only in quotation marks.

Aging↗
PubMed1999

[The targetted delivery of antitumor preparations by using protein vectors].

The prospects of the endocytosis-mediated targeted delivery of antitumor drugs to the target cells by means of vector proteins, such as nerve growth factor (NGF), epidermal growth factor (EGF), and the oncofetal protein alpha-fetoprotein (AFP), are discussed. The high selectivity and efficiency of antitumor effects of synthetic covalent EGF- and AFP-conjugates with chemical agents (antitumor antibiotics) and antisense oligonucleotides are compared with individual biologically active compounds in in vitro and in vivo animal studies. The molecular mechanisms of action of the above conjugates have been studied. Evidence is given for the fact that it is expedient to use them to overcome multidrug resistance in the clinical setting. The findings are the first important step in designing novel target antitumor drugs based on biologically active vector proteins showing their effects by receptor-mediated endocytosis.

Animals↗
PubMed1998

New DNA diagnostic system for detection of factor V Leiden.

Use was made of allele-specific PCR to develop a highly effective DNA diagnostic system for detection of the factor V Leiden mutation in exon 10 of human factor V gene. The allele-specific primers contain a 3'-OH end nucleotide, which matches a mutant or wild-type nucleotide of the template DNA (A-allele and G-allele, respectively) and also one mismatched nucleotide near the 3'-end. The universal primers have an internal mismatch with the mutant nucleotide of the template DNA and another mismatched nucleotide at 3'-OH end. The A-allele-specific primer enables the preferential amplification of both the homozygous and heterozygous mutant alleles. The extension of the G-allele-specific primer or the universal one is inhibited in the presence of the homozygous factor V Leiden. The developed assay system allowed us to detect five patients, who are heterozygous for factor V Leiden among the 48 patients with deep venous thrombosis and pulmonary thromboembolism.

Alleles↗
PubMed1998

Epitope mapping of anti-troponin I monoclonal antibodies.

Two groups of monoclonal antibodies (MAbs) specific to human cardiac troponin I (cTnI) were generated by immunization of mice by isolated cTnI (group I, 16 MAbs) or by the whole troponin complex (group II, 15 MAbs). Two sets of overlapping decapeptides covering the complete sequence of cTnI were prepared and used for epitope mapping by SPOT technique. Majority of MAbs (28 out of 31) interacts with synthetic peptides thus indicating that they recognize liner epitopes. MAbs raised against isolated cTnI preferentially recognize epitopes located at the N- or C-terminal ends of cTnI. Nine out of fifteen MAbs raised against whole troponin complex interact with epitopes located in the N-terminal part of cTnI. Generation of MAbs recognizing both isolated cTnI and cTnI inside of troponin complex and mapping their epitopes provides reliable detection of TnI in serum of patients with acute myocardial infarction.

Amino Acid Sequence↗
PubMed1998

[Molecular mechanisms of prostatic oncogenesis].

A model of effector and regulatory determinants of the rate and coordination of proliferation of epithelial and stromal cells in the normal prostate in benign hyperplasia and cancer of the prostate was developed. The direct effector factors-protein growth factors, the regulatory factors: activators (5-alpha-reductase, dehydrotestosterone, prostatic specific antigen) and inhibitors (tumor suppressors and metastatic suppressors, insulin-like growth factor-binding protein type 3) were analyzed and systematized. The molecular mechanisms responsible for the occurrence and progression of prostatic tumors, the role of the above factors, genetic changes in the chromosomes and genes, impaired coordination in the action of oncogenes and antioncogenes were under investigation. Directions of experimental search for the earlier unknown links in the analyzed system are outlined. The prospects for designing and using new diagnostic and prognostic omcomarkers and new means for the prevention and treatment of benign hyperplasia and cancer of the prostate are defined.

3-Oxo-5-alpha-Steroid 4-Dehydrogenase↗
PubMed1997

Alpha-fetoprotein-mediated targeting--a new strategy to overcome multidrug resistance of tumour cells in vitro.

The possibility of overcoming the multidrug resistance of human malignant cells by using doxorubicin conjugated to alpha-fetoprotein (AFP) was studied. It was shown that this type of antitumour drugs, penetrating the cell by receptor-mediated endocytosis with AFP as a vehicle, raises the sensitivity of the tumour cells that are resistant due to the expression of the multidrug resistance gene mdr1. The sensitivity of antibiotic-resistant cell lines SKVLB (a human ovarian carcinoma) and MCF-7 AdrR (a human breast carcinoma) increased by 10- and 4-fold, respectively, when AFP-conjugated doxorubicin was used. The rationale of using human AFP-antitumour drug conjugates for the development of new chemotherapeutic approaches to cancer treatment is discussed.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1997

Isolation and characterization of AFP-binding proteins from tumor and fetal human tissues.

The AFP receptor (rAFP) was discovered in embryonal and tumor tissues with a high level of proliferation. The AFP-binding protein (AFPbp) possibly containing the AFP-receptor (rAFP) was isolated from human embryos and human breast cancer tissue using affinity chromatography on an AFP-Sepharose column. The similarity of molecular weight, subunit composition, and immunological characteristics was shown for embryonal and tumor AFPbp using immunoblotting, gel-filtration, and PAAG electrophoresis. Judging from Superose-12 gel-filtration data, the protein molecular weight made up to 320-380 kDa. The presence of an IgG-binding site was detected in embryonal and tumor AFPbp by Western blot analysis.

Antibodies, Monoclonal↗
PubMed1997

Antitumor activity of conjugates of the oncofetal protein alpha-fetoprotein and phthalocyanines in vitro.

The several conjugates of aluminium and cobalt complexes of phthalocyanines with human alpha-fetoprotein have been synthesized. Their cytotoxic activity against tumor cells and human peripheral blood lymphocytes was studied. The experimental data demonstrate that the cytotoxic activity of alpha-fetoprotein-phthalocyanine conjugates against three types of tumor cells of various origin is much higher (for aluminium and cobalt complexes more than 1000 and 50 times, respectively) in comparison with phthalocyanines themselves. The application of phthalocyanines as conjugates with alpha-fetoprotein makes it possible to markedly enhance the selective toxicity of phthalocyanines against human tumor cells.

Aluminum↗
PubMed1997

Antitumor activity of conjugates of the oncofetal protein alpha-fetoprotein and phthalocyanines in vitro.

The several conjugates of aluminium and cobalt complexes of phthalocyanines with human alpha-fetoprotein have been synthesized. Their cytotoxic activity against tumor cells and human peripheral blood lymphocytes was studied. The experimental data demonstrate that the cytotoxic activity of alpha-fetoprotein-phthalocyanine conjugates against three types of tumor cells of various origin is much higher (for aluminium and cobalt complexes more than 1000 and 50 times, respectively) in comparison with phthalocyanines themselves. The application of phthalocyanines as conjugates with alpha-fetoprotein makes it possible to markedly enhance the selective toxicity of phthalocyanines against human tumor cells.

Aluminum↗
PubMed1997

[New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias].

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5')TAAGAGCAGATCCCTGGACAGCCA and (5')TAAGAGCAGATCCCTGGACACGCA), contained a 3'-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3'-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.

Alleles↗