Search PubMed⌕ Search

Biomedical subjects

E Randerath

Publications and source records attributed to E Randerath.

At least 91 records · Page 5Linked to original sources
PubMed1981

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp.

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.

Animals↗
PubMed1981

Lack of a specific ribose methylation at guanosine 17 in Morris hepatoma 5123D tRNASer1IGA.

Tumor transfer RNA's (tRNA's) frequently exhibit alterations in column chromatographic profiles and in base compositions when compared to their normal counterparts. Because such alterations may be involved in the dedifferentiated state of cancer cells, it is of interest to determine their structural basis and functional significance. The recent development of highly sensitive postlabeling methods has now made possible sequence analysis of tRNA's from neoplastic tissues available only in limited amounts. We have determined the nucleotide sequence of Morris hepatoma serine tRNA (anticodon IGA) and compared it with its normal counterpart in rat liver. The tumor serine tRNA was found to lack the ribose methylation of guanosine in position 17 of the dihydrouridine loop present in the liver RNA. This result explains the column chromatographic shifts of Morris hepatoma 5123D seryl-tRNA isoacceptors, suggesting that all seryl-tRNA isoacceptors may lack this modification.

Animals↗
PubMed1980

Isolation and sequence analysis of two major leucine transfer ribonucleic acids (anticodon Mm-A-A) from a rat tumor, Morris hepatoma 5123D.

The nucleotide sequences of two major tRNALeu species (anticodon Mn-A-A)isolated from Morris hepatoma 5123D were determined by a combination of a newly developed thin-layer readout sequencing method [Gupta, R. C., & Randerath, K. (1979) Nucleic Acids Res. 6, 3443-3458] and additional 3H- and 32P-labeled derivative methods entailing chromatographic fingerprinting and base-specific enzymatic cleavages. The nucleotide sequence of the two hepatoma tRNAMm-A-ALeu species, one of which has U and the other of which has A in position 50 at the tip of the long extra arm, is pG-U-C-A-G-m2G-A-U-G-(m2)G-C-(ac4)C-G-A-G-U-G-G-D-C-psi-A-A-G-G-C-m22G-C-C-A-G-A--C-U-Mm-A-A-m1G*-psi-psi-C-U-G-G-L-(psi)U-C-C-G-U- or A-A-U-G-G-A-G-m5C-G-U-G-G-G-T-psi-C-G-m1A-A-U-C-C-C-A-C-U-U-C-U-G-A-C-A-C-C-AOH. These are the first leucine tRNA sequences from higher eukaryotes that have been determined. Noteworthy features of the mammalian leucine tRNAs are the presence of psi in the beta region of the D loop and the occurrence of three unknown hypermodified nucleosides (Mm, m1G*, and L) in positions 35, 38, and 45, respectively. m1G* was converted to m1G by treatment with alkali. Sequencing gels indicated that the parent base of the 2'-O-methylated nucleoside Mm may be a pyrimidine, probably a C derivative, as indicated by the chromatographic behavior of nucleotides containing Mm. The presence of a pyrimidine in the wobble position would be consistent with the antidodon sequence Mm-A-A and the leucine condons U-U-G and U-U-A. The occurrence of a hypermodified nucleoside, L, in the first position of the long extra arm appears unusual; thus far the only modified nucleoside found in this position is Um in eukaryotic serine tRNAs. Since all tRNAs with a long extra arm sequenced to date have a pyrimidine in this position, L is likely to be a pyrimidine, probably a U derivative, as inferred from chromatographic data.

Animals↗
PubMed1979

Yeast tRNA Leu UAG. Purification, properties and determination of the nucleotide sequence by radioactive derivative methods.

A second major species of leucine tRNA, tRNA Leu UAG (formerly designated tRNA Leu CUA) was purified from baker's yeast in a three-step procedure entailing BD-cellulose chromatography in the presence and absence of Mg2+ and Sephadex G-100 gel filtration. Results of aminoacylation and partial RNase T1 digestion experiments showed that this tRNA retains a native conformation under conditions that denature yeast tRNA Leu m5CAA (tRNA3 Leu). The primary structure of baker's yeast tRNA Leu UAG was elucidated by application of sensitive radioactive isotope derivative ("postlabeling") methods. Complete RNase T1 and A and partial RNase U2 fragments, prepared from non-radioactive tRNA and 5'-half and 3'-half molecules, were separated by two-dimensional polyethyleneimine-cellulose anion-exchange thin-layer chromatography and isolated by a novel micropreparative procedure affording high yields of these compounds in sufficient purity for subsequent tritium derivative analysis. Base composition and sequence of oligonucleotides were analyzed by tritium derivative methods. Molar ratios of the fragments were determined from the radioactivity of 3H-labeled nucleoside trialcohols in combination with base analysis. 2'-O-Methylated guanosine was characterized using the [gamma-32P]ATP/polynucleotide kinase reaction. The analysis of classical complete and partial RNase digests by the tritium derivative methods yielded the complete nucleotide sequence of the tRNA. A total of about 20 A260 units of the RNA was used for analysis, i.e. considerably less material than required for conventional spectrophotometric analysis. A different sequencing approach, consisting of a combination of "readout sequencing" with tritium sequencing of complete RNase T1 and A fragments, was applied to the 3'-half molecule. The 3'-half molecule was labeled with 32P at its 5' terminus, partially degraded with RNase T1, U2, and Phy1 and with alkali, and subjected to polyacrylamide gel electrophoresis. The sequence was read off the gel on the basis of cleavage patterns and size of the fragments. While the readout procedure provided only the positions of A, U, C, and G residues in the chain, additional information from tritium derivative analysis was utilized to define the positions of the modified nucleosides. The readout sequencing procedure was found to require less than 0.01 A260 unit of RNA and the analysis of the complete fragments about 6 A260 units. Interesting structural features of tRNA Leu UAG are (a) the location of unique, leucine tRNA iso-acceptor-specific sequences next to U-8, a constant nucleotide participating in synthetase recognition, (b) the occurrence of 1-methyladenosine in the T loop, a modification not present in the structurally related tRNA Leu m5CAA, and (c) the unusual presence of an unmodified uridine in the first position of the anticodon, which may be related to the unusual coding properties reported for this tRNA.

Adenine↗
PubMed1978

Base composition studies on transfer RNA from normal and regenerating rat liver.

The base composition of bulk tRNA isolated from regenerating rat liver, 12, 18, 24 and 30 h after partial hepatectomy, was determined by a 3H derivative method. Only a few minor statistically significant changes (2--11%), as compared to sham-operated liver, were found at 18, 24 and 30 h after hepatectomy. These included a reduction in the amounts of adenosine and 3-(3-amino-3-carboxypropyl)-uridine, and an increase in the amounts of 1-methyl-adenosine, 1-methylguanosine, 3-methylcytidine and pseudouridine. Similarly, when the base composition of tRNA fractions from control and 24-h regenerating rat liver, partially purified by one-dimensional polyacrylamide gel electrophoresis, was determined, no gross differences were observed. These results suggest that the process of liver regeneration is not accompanied by a gross alteration of the modification pattern of tRNA.

Animals↗
PubMed1976

Base composition studies on mitochondrial 4 S RNA from rat liver and Morris hepatomas 5123D and 7777.

The major and modified base composition of mitochondrial 4 S RNA from rat liver and from Morris hepatomas 5123D and 7777 has been determined for 16 constituents using a chemical tritium-derivative method. The base composition of these mitochondrial 4 S RNA preparations was compared with the base composition of cytoplasmic and bacterial (Escherichia coli B and Bacillus subtilis) 4-S RNAs. The results of these studies are: 1. When compared with cytoplasmic 4 S RNA, the liver and hepatoma mitochondrial 4-S RNAs are characterized by high (A + U)/(G + C) ratios and low overall degrees of base methylation and modification. 2. The mammalian mitochondrial 4-S RNAs are qualitatively even more different from the bacterial 4-S RNAs than from their cytoplasmic counterparts. Thus, several modified constituents found in both cytoplasmic and mitochondrial 4 S RNA are absent from the bacterial 4-S RNAs. 3. Mitochondrial 4S RNA from both hepatomas was found to be under-methylated and undermodified when compared with normal liver mitochondrial 4S RNA. This trend is more pronounced for the rapidly growing hepatoma 7777 (i.e., 17% undermethylation) than for the more slowly growing hepatoma 5123D (i.e., 8% undermethylation). These findings are discussed in relationship to (1) results of other authors on composition of mitochondrial 4 S RNA, (2) special features of structure and biosynthesis of mitochondrial 4 S RNA, (3) the possible evolutionary origin of mitochondria and (4) the possible role played by aberrant mitochondrial 4 S RNA in altered mitochondrial protein synthesis in tumors.

Animals↗
PubMed1976

A double-labeling procedure for sequence analysis of picomole amounts of nonradioactive RNA fragments.

A double-labeling procedure for sequence analysis of nonradioactive polyribonucleotides is detailed, which is based on controlled endonucleolytic degradation of 3'-terminally (3H)-labeled oligonucleotide-(3') dialcohols and 5"-terminal analysis of the partial (3H)-labeled fragments following their separation according to chain length by polyethyleneimine- (PEI-)cellulose TLC and detection by fluorography. Undesired nonradioactive partial digestion products are eliminated by periodate oxidation. The 5'-termini are assayed by enzymic incorporation of (32p)-label into the isolated fragments, enzymic release of (32p)-labeled nucleoside-(5') monophosphates, two-dimensional PEI-cellulose chromatography, and autoradiography. Using this procedure, as little as 0.1 - 0.3 A260 unit of tRNA is needed to sequence all fragments in complete ribonuclease T1 and A digests, whereas radioactive derivative methods previously described by us1-4 required 4 - 6 A260 units.

Base Sequence↗
PubMed1976

An improved separation procedure for nucleoside monophosphates on polyethyleneimine-(PEI-)cellulose thin layers.

A procedure is described for the two-dimensional separation of the 4 major and 16 modified nucleoside-(5') monophosphates on anion-exchange thin layers of polyethyleneimine- (PEI-)cellulose. The method, which is simple and less time-consuming than existing partition chromatographic methods, may be used for the identification of 5'-termini of RNA and RNA fragments.

Chromatography, Ion Exchange↗
PubMed1974

Tritium sequence analysis of oligoribonucleotides: a combination of post-labeling and thin-layer chromatographic techniques for the analysis of partial snake venom phosphodiesterase digests.

A tritium derivative method for sequence analysis of polyribonucleotides is detailed, which is based on borotritide reduction of oligonucleotide-3' dialdehydes generated by controlled snake venom phosphodiesterase/alkaline phosphomonoesterase digestion and periodate treatment of time point aliquots of the incubation mixture. Radioactive oligonucleotide derivatives are resolved according to chain length by PEI-cellulose(1) anion-exchange TLC and their 3'-termini identified by techniques described in the preceding paper of this series(2). The present tritium derivative method is compared with the one described previously(2).

Borohydrides↗
PubMed1974

Sequence analysis of nonradioactive RNA fragments by periodate-phosphatase digestion and chemical tritium labeling: characterization of large oligonucleotides and oligonucleotides containing modified nucleosides.

A tritium derivative method for sequence analysis of polyribonucleotides is detailed, which is based on borotritide reduction of oligonucleotide dialdehydes generated by treatment of polyribonucleotides with alkaline phosphatase and excess periodate at pH 8 (borate buffer; no primary amine present in the reaction mixture). While neither phosphatase nor periodate possess any intrinsic exonuclease activity their combination mimics an RNA-specific exonuclease ("pseudo-exonuclease"). Procedures are described for separation and characterization of tritiumlabeled oligonucleotide derivatives. The sequence is deduced by identification of labeled 3'-termini following separation of the reduced nucleotide intermediates according to chain length. The sensitivity of the method is indicated by the fact that as little as 0.01 O.D.260 unit of a nonradioactive decanucleotide is sufficient for sequence determination.

Alkaline Phosphatase↗