Search PubMed⌕ Search

Biomedical subjects

E Ohtsuka

Publications and source records attributed to E Ohtsuka.

At least 181 records · Page 10Linked to original sources
PubMed1990

Crystal structure of an active form of RAS protein, a complex of a GTP analog and the HRAS p21 catalytic domain.

Normal RAS proteins play a key role of molecular switch in the transduction of the growth signal from extracellular to intracellular space. The state of the switch is "on" when GTP is bound and "off" when GDP is bound to the protein. The crystal structure of a complex between a nonhydrolyzable GTP analog and the catalytic domain of a RAS protein has been determined by a rotation-translation search method. The orientations and positions of four independent molecules have been determined using a single molecule as a probe in the search. The crystal structure reveals that the gamma phosphate of the GTP analog induces extensive conformational changes on two loop regions of the protein.

Amino Acid Sequence↗
PubMed1990

Surveying cis-acting sequences of pre-mRNA by adding antisense 2'-O-methyl oligoribonucleotides to a splicing reaction.

We chemically synthesized antisense 12 mer 2'-O-methylribonucleotides and surveyed a scanning (signal-tracking) process as well as sequences within a beta-globin transcript acting in the splicing reaction in vitro. The pre-mRNA transcript contained the sequences of the first exon, first intron, and a major part of the second exon of the human beta-globin gene. We found that the antisense 2'-O-methylribonucleotides could anneal effectively to the target site in the pre-mRNA during the splicing reaction. A 2'-O-methylribonucleotide complementary to the donor (5') splice site completely inhibited authentic splicing and activated an upstream cryptic donor site. A 2'-O-methylribonucleotide complementary to the branch site inhibited normal branch formation and greatly reduced subsequent generation of the spliced product. Six other 2'-O-methylribonucleotides complementary to loci in the exons or the intronic region between the donor and branch sites had no significant effect on the splicing reaction. These observations suggest that an extensive scanning of the present pre-mRNA across the six regions tested is not essential for the splicing reaction. We propose that a short antisense 2'-O-methylribonucleotide provides a practical and convenient method to examine cis-acting sequences of RNA. The advantages of this method in comparison with site-directed mutagenesis or deletion are discussed.

Base Sequence↗
PubMed1990

c-Ha-ras down regulates the alpha-fetoprotein gene but not the albumin gene in human hepatoma cells.

We studied the effects of transfection of the normal c-Ha-ras gene, rasGly-12, and its oncogenic mutant, rasVal-12, on expression of the alpha-fetoprotein (AFP) and albumin genes in a human hepatoma cell line, HuH-7. The mutant and, to a lesser extent, the normal ras gene caused reduction of the AFP mRNA but not the albumin mRNA level in transfected HuH-7 cells. Cotransfection experiments with a rasVal-12 expression plasmid and a chloramphenicol acetyltransferase reporter gene fused to AFP regulatory sequences showed that rasVal-12 suppressed the activity of enhancer and promoter regions containing A + T-rich sequences (AT motif). In contrast, rasVal-12 did not affect the promoter activity of the albumin and human hepatitis B virus pre-S1 genes even though these promoters contain homologous A + T-rich elements. ras transfection appeared to induce phosphorylation of nuclear proteins that interact with the AFP AT motif, since gel mobility analysis revealed the formation of slow-moving complexes which was reversed by phosphatase treatment. However, similar changes in complex formation were observed with the albumin and hepatitis B surface antigen pre-S1 promoters. Therefore, this effect alone cannot explain the specific down regulation of the AFP promoter and enhancer activity. ras-mediated suppression of the AFP gene may reflect the process of developmental gene regulation in which AFP gene transcription is controlled by a G-protein-linked signal transduction cascade triggered by external growth stimuli.

Antibodies, Monoclonal↗
PubMed1990

Chemical synthesis of oligoribonucleotides for structural studies.

Large-scale synthesis of oligoribonucleotides has been performed successfully on a solid support by the phosphoramidite approach using levulinyl and tetrahydrofuranyl protection for the 5'- and 2'-hydroxyl groups respectively. A hexamer containing inosine and four fragments of a hammerhead-type ribozyme have been synthesized on a 10 mumol scale for structural studies by NMR spectroscopy and X-ray crystallography.

Base Sequence↗
PubMed1989

Conformation of guanosine 5'-diphosphate as bound to a human c-Ha-ras mutant protein: a nuclear Overhauser effect study.

1H NMR spectra of a GDP/GTP-binding domain of human c-Ha-ras gene product (residues 1-171) in which glutamine-61 was replaced by leucine [ras(L61/1-171) protein] were analyzed. By one-dimensional and two-dimensional homonuclear Hartmann-Hahn spectroscopy and nuclear Overhauser effect (NOE) spectroscopy of the complex of the ras(L61/1-171) protein and GDP, the ribose H1', H2', H3', and H4' proton resonances of the bound GDP were identified. The guanine H8 proton resonance of the bound GDP was identified by substituting [8-2H]GDP for GDP. The dependences of the H1' and H8 proton resonance intensities on the duration of irradiation of the H1', H2', H3', and H8 protons were measured. By numerical simulation of these time-dependent NOE profiles, the conformation of the protein-bound GDP was elucidated; the guanosine moiety takes the anti form about the N-glycosidic bond with a dihedral angle of chi = -124 +/- 2 degrees and the ribose ring takes the C2'-endo form. Such an analysis of the conformation of a guanine nucleotide as bound to a GTP-binding protein will be useful for further studies on the molecular mechanism of the conformational activation of ras proteins on ligand substitution of GDP with GTP.

Base Sequence↗
PubMed1989

Synthesis of a gene for the protein kinase domain of the epidermal growth factor receptor and its expression in Escherichia coli.

A gene encoding the protein kinase domain of the epidermal growth factor receptor has been chemically synthesised, cloned and expressed in Escherichia coli. The 942-base-pair gene was constructed by enzymatic ligation of 56 oligonucleotides and cloned into an expression vector downstream of the E. coli trp promoter. Production of active gene product was confirmed by means of a protein kinase assay, demonstrating that the enzymatic activity of the protein kinase domain of the epidermal growth factor receptor is retained after expression in E. coli.

Amino Acid Sequence↗
PubMed1989

Design of RNA enzymes distinguishing a single base mutation in RNA.

RNA enzymes (ribozymes) which can cleave RNA by recognizing sequences of 9-15 bases are described. Substrates must contain UX (X = U, C or A). A ribozyme consisting of two oligoribonucleotides (19 mer and 15 mer) was shown to cleave a ribo 11 mer catalytically with Km and kcat values of 0.53 microM and 0.03 min-1, respectively. A non-cleavable substrate-ribozyme complex containing 2'-O-methylnucleoside was prepared and CD spectra were compared at different temperature. In order to obtain an efficient ribozyme, a one-strand RNA with a chain length of 37 was prepared. The ribozyme was shown to distinguish a single base mutation in mRNA's which were prepared by transcription of two synthetic DNA duplexes coding for positions 7-26 of c-Ha-ras protein. The mutant (Val-12) mRNA which had GUU was cleaved but the wild type mRNA which contained GGU was not changed, when treated by the ribozymes in the presence of Mg2+.

Base Sequence↗
PubMed1989

Affinity of single- or double-stranded oligodeoxyribonucleotides containing a thymine photodimer for T4 endonuclease V.

A gene for T4 endonuclease V was constructed by joining chemically synthesized oligodeoxyribonucleotides and expressed efficiently in Escherichia coli under the control of the E. coli tryptophan promoter. Overproduced T4 endonuclease V, which can cleave thymine photodimers as well as the corresponding phosphodiester linkage of DNA, was used to investigate the precise mode of the reaction with single- or double-stranded synthetic DNA fragments containing a thymine photodimer. The substrates, three oligodeoxyribonucleotides, d(GCGGTTGGCG) (10-mer), d(CGAAGGTTGGAAGC) (14-mer), and d(CACGAAGGTTGGAAGCAC) (18-mer), were prepared by UV irradiation of the nascent oligonucleotides. These single-stranded oligonucleotides were cleaved by the enzyme with a concentration 100 times higher than that required for the corresponding duplexes. The Km values for the TT duplex (14- and 18-mer) were found to be on the order of 10(-8) M. Dissociation constants for the 14- and 18-mer duplexes were measured by a binding assay on a nitrocellulose filter and found to be 10(-9).

Amino Acid Sequence↗
PubMed1989

Structural differences between a ras oncogene protein and the normal protein.

One of the most commonly found transforming ras oncogenes in human tumours has a valine codon replacing the glycine codon at position 12 of the normal c-Ha-ras gene. To understand the structural reasons behind cell transformation arising from this single amino acid substitution, we have determined the crystal structure of the GDP-bound form of the mutant protein, p21(Val-12), encoded by this oncogene. We report here the overall structure of p21(Val-12) at 2.2 A resolution and compare it with the structure of the normal c-Ha-ras protein. One of the major differences is that the loop of the transforming ras protein that binds the beta-phosphate of the guanine nucleotide is enlarged. Such a change in the 'catalytic site' conformation could explain the reduced GTPase activity of the mutant, which keeps the protein in the GTP bound 'signal on' state for a prolonged period time, ultimately causing cell transformation.

Crystallography↗
PubMed1989

Microinjection of T4 endonuclease V produced by a synthetic denV gene stimulates unscheduled DNA synthesis in both xeroderma pigmentosum and normal cells.

A structural gene for T4 endonuclease V was constructed by ligating synthetic oligonucleotides. The endonuclease V was overproduced in E. coli under control of the E. coli tryptophan promoter and purified to apparent homogeneity. The product had comparable DNA glycosylase and apurinic/apyrimidinic (AP) endonuclease activities to the natural enzyme in vitro. When this endonuclease V was microinjected into the cytoplasm of xeroderma pigmentosum (XP) cells of complementation group A, B, C, D, F, G or H, unscheduled DNA synthesis (UDS) above the residual level was detected in all the cells at a dose of about 10(3) molecules following UV irradiation. The gain numbers of UDS in these XP cells increased with increase in the dose of enzyme and reached a plateau at the normal cell level on introduction of about 10(4) molecules. Introduction of more enzyme into either XP cells or normal human cells did not increase the grain number under regular labelling conditions (2.5 h, 37 degrees C). In normal mouse cells, introduction of the enzyme increased the grain number more than 4-fold under the same conditions during at least 8.5 h following UV irradiation. Furthermore, with a labelling time of 30 min, the enzyme more than doubled the grain number even in normal human cells.

Animals↗
PubMed1989

Transformation of NIH3T3 cells with synthetic c-Ha-ras genes.

Synthetic human c-Ha-ras genes in which amino acid codons were altered to those which are frequently used in highly expressed Escherichia coli genes were ligated to the 3'-end of Rous sarcoma virus long terminal repeat. When NIH3T3 cells were transfected with the plasmids having those genes with valine at codon 12, leucine at codon 61 or arginine at codon 61, transformants were efficiently produced. These results indicated that the synthetic c-Ha-ras genes are expressed in a mammalian system even though their codon usage is altered to correspond with that of E. coli. This expression vector system should be useful for studies on the structure-function relationships of c-Ha-ras, since the synthetic gene can be easily modified to have multiple base alterations, and can also be used simultaneously for the production of large amounts of p21 in E. coli for biochemical and biophysical studies.

Avian Sarcoma Viruses↗
PubMed1989

Design of RNA enzymes for sequence-dependent cleavage of RNA.

We have designed synthetic ribozymes which can cleave specific sites of RNA. An undecamer, 5S rRNA and transcripts using T7 RNA polymerase were hydrolyzed at the X position of RNA containing (N)nUX(N)n (N = A, G, C and U; X = A, C and U) by these ribozymes.

Base Sequence↗
PubMed1988

Cleavage of specific sites of RNA by designed ribozymes.

Two ribozymes were designed for site-specific cleavage of RNA. A UA site in an undecaribonucleotide was cleaved by a ribozyme consisting of two partially paired oligoribonucleotides with chain lengths of 19 and 15. The other ribozyme, which consists of a 19-mer and a 13-mer, recognized a UC sequence at positions 42 and 43 of 5 S rRNA.

Base Sequence↗
PubMed1988

5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.

Aminolevulinic Acid↗
PubMed1988

Preliminary crystallographic study of pyrimidine dimer-specific excision-repair enzyme from bacteriophage T4.

Bacteriophage T4 endonuclease V, which is an excision-repair enzyme specific to pyrimidine dimers within DNA, has been crystallized from polyethylene glycol 4000 solution by a vapour diffusion technique. The unit cell is monoclinic, space group P2(1), with unit cell parameters: a = 41.4 A, b = 40.1 A, c = 37.5 A, beta = 90.01 degrees. The unit cell contains two 16,000 Mr molecules. The crystals diffract X-rays beyond 2.3 A resolution and are suitable for structural analysis at high resolution.

Crystallography↗
PubMed1988

Crystallization and preliminary crystallographic data of a truncated derivative from the human c-Ha-ras protein.

A truncated derivative of the human c-Ha-ras protein has been crystallized from polyethylene glycol 6000 solution by a vapour diffusion technique. The rectangular prism diffracts X-rays to at least 2.5 A resolution (1 A = 0.1 nm). The unit cell is monoclinic, space group P21, with unit cell parameters of a = 50.2 A, b = 110.9 A, c = 36.4 A, beta = 97.2 degrees. The unit cell contains four molecules.

Crystallization↗