Search PubMed⌕ Search

Biomedical subjects

E F Wong

Publications and source records attributed to E F Wong.

29 records · Page 2Linked to original sources
PubMed1990

Single copy sequences in galago DNA resemble a repetitive human retrotransposon-like family.

Galago DNA contains a few single copy sequences that are homologous to the human THE 1 family of repeats. Two of these galago loci have been isolated as genomic clones and their structures are compared to the THE 1 consensus sequence. Whereas the human sequence resembles a proretroviral transposon, the galago sequences provide no evidence for a proretroviral sequence organization. The two galago clones share a common repeat sequence, which is homologous to the U5 region of the THE 1 long terminal repeat. Immediately 3' to this repeat, each galago clone contains sequences that are homologous to mutually exclusive regions of the internal THE 1 sequence. Thus, the human THE 1 sequence can be represented as a mosaic of the two ancestrally related galago loci. The galago loci are transcribed in vivo, so that their conservation in the primate genome could be selected. Human THE 1 repeats apparently resulted by recruiting preexisting cellular sequences via a retrovirally mediated process.

Animals↗
PubMed1990

Atrial natriuretic factor levels in renal stone patients with idiopathic hypercalciuria and in healthy controls: the effect of an oral calcium load.

Ionized calcium is a stimulator for the release of several peptide hormones. Atrial natriuretic factor (ANF) is a peptide hormone released from atrial tissue in response to atrial distension or volume expansion. In the present study, we have examined the effect of an oral calcium load in healthy controls and renal stone patients with idiopathic hypercalciuria. Our results demonstrated that ANF release increased in both groups in response to a calcium load. However, idiopathic hypercalciuric patients presented lower basal ANF levels in the presence of high calcitriol levels. The role of calcitriol on ANF release remains to be evaluated.

Adult↗
PubMed1990

Plasma levels of atrial natriuretic peptide during labour and in puerperium.

Atrial natriuretic peptide (ANP), a new cardiac hormone, has potent natriuretic, diuretic and vaso-relaxant properties in animals and humans. Plasma ANP levels increased in response to volume expansion, atrial distension or postural change. The present investigation was designed to examine the effect of labour on plasma ANP in normotensive pregnant women. The results show that plasma ANP in pregnant women (n = 9) increased significantly in active phase of first stage of labour from 19.5 +/- 4.6 pg/ml to 74.5 +/- 15.1 pg/ml. The magnitude of the increase in ANP levels in active phase varied among the patients. During and after delivery, plasma ANP decreased in all instances towards control level. The cause for the increase in plasma ANP levels in the active phase remains to be determined.

Atrial Natriuretic Factor↗
PubMed1990

[Plasma levels of atrial natriuretic factor (ANF) in the stroke patients after glycerol and mannitol infusion].

This study included 43 patients with stroke in a range of 48 to 85 years of age. Among them, 24 were male and 19 were female. Changes in blood pressure, plasma ANF (by radioimmunoassay), serum sodium, and serum osmolarity before and 40 minutes after hyperosmotic agents infusion were studied. The stroke was classified to be putaminal hemorrhage in 12 cases, thalamic hemorrhage in 5 cases, putaminothalamic hemorrhage in 2 cases, lobar hematoma in 2 cases, cerebral infarction in 20 cases and brainstem ischemic stroke in 2 cases. Twenty-nine patients received glycerol and the other fourteen received mannitol. After glycerol or mannitol infusion, the plasma ANF raised significantly (P less than 0.05, paired Student's test), also the serum osmolarity (P less than 0.05, paired Student's t test), but the blood pressure and serum sodium kept unchanged. Either before or after the hyperosmotic agents, no significant difference in plasma ANF was noted between the hemorrhagic and infarction patients, between the right and the left hemispheric stroke, or between male and female patients. We did not observe age-related (less than 65 or greater than 65 years) difference in plasma ANF concentration in this study, either.

Aged↗
PubMed1989

Effects of thyroid status on atrial natriuretic peptide release from isolated rat atria.

The effect of thyroid hormone on circulating levels of atrial natriuretic peptide (ANP) was studied in experimental hyperthyroid and hypothyroid rats. Plasma ANP was 102 +/- 5 pg/ml in euthyroid rats, 82 +/- 4 pg/ml in hypothyroid rats, and 138 +/- 11 pg/ml in hyperthyroid rats. We have also measured immunoreactive ANP in the atria of euthyroid, hypothyroid, and hyperthyroid rats. ANP content and concentration in the atria were lower (546 +/- 32 pg/mg tissue) in hyperthyroid rats than in hypothyroid rats (802 +/- 74 pg/mg tissue). Right atrium from euthyroid, hypothyroid, and hyperthyroid rats was superfused with a modified Langendorff preparation. Spontaneous release of ANP was significantly higher from the hyperthyroid rats (20 +/- 2 pg.min-1.mg-1) than from the hypothyroid rats (5.6 +/- 0.5 pg.min-1.mg-1). ANP release from the euthyroid rats was 9.3 +/- 1.2 pg.min-1.mg-1. These results indicate hyperthyroidism causes an increase in ANP secretion and a decreased release occurs during hypothyroidism.

Animals↗
PubMed1988

The differential response in atrial natriuretic peptide release during exercise in patients with and without ischemic heart disease.

The elevation of cardiac filling pressure induces the release of atrial natriuretic peptide into the circulation. Ischemia during exercise in patients with coronary artery disease may manifest itself with elevation of cardiac filling pressure before the onset of electrocardiographic changes or chest pain. Thus, patients with ischemic heart disease might have an elevated circulating atrial natriuretic peptide after exercise. The present study investigated the effect of exercise on circulating atrial natriuretic peptide in patients with and without ischemic heart diseases. Group 1 was composed of five patients who had ischemic heart disease by clinical history, previous myocardial infarction, angina or angiographically proven coronary artery disease and positive electrocardiogram during exercise. Group 2 was composed of five patients without ischemic heart disease and negative electrocardiogram response. Heart rate, blood pressure, and atrial natriuretic peptide were measured during routine treadmill exercise testing using the Bruce protocol. Our results indicate that the rate of rise of heart rate (12.3 +/- 1.8 vs. 8.5 +/- 0.7 beats/min/min), blood pressure (7.1 +/- 1 vs. 4.2 +/- 0.8 mm Hg/minute), and atrial natriuretic peptide (4.1 +/- 1 vs. 1.4 +/- 0.3 pg/ml/min) was significantly elevated in patients with ischemic heart disease compared to the group 2 patients. These findings suggest that the disproportionate elevation of atrial natriuretic peptide after exercise in ischemia may be caused by elevation of cardiac filling pressure, which may provide a noninvasive method for the diagnosis of ischemic heart disease.

Adult↗
PubMed1988

Effect of sinus node on spontaneous release of natriuretic peptide in isolated atria.

Experiments were conducted to examine the release of atrial natriuretic peptide (ANP) in an isolated atrium in the presence and absence of sinus node tissue. The first series of experiments were conducted with the aid of a metabolic chamber to examine the spontaneous release of ANP by the right atrium with and without the sinus node region. The left atrium was also studied. The right atrium with the sinus node, quiescent right atrium without the sinus node, and the left atrium were incubated at 35 degrees C in 10 mL of oxygenated Tyrode's solution. After 40 min of equilibration, the incubation medium was removed at 10-min intervals for the determination of immunoreactive ANP concentration. The right atria with the sinus node released the highest amount of ANP into the incubation medium (32.2 +/- 2.7 pg.min-1.mg-1), compared with quiescent right atria (20.9 +/- 3.7 pg.min-1.mg-1). The left atria released the least amount of ANP into the incubation medium (9.9 +/- 1.5 pg.min-1.mg-1) when compared with the quiescent right atria and the right atria. In the second series of experiments, the right atrium was divided into the sinus node region and the quiescent right atrium, and these tissues were studied in paired fashion with a modified Langendorff preparation. The right atrium without the sinus node and sinus node region were perfused with Tyrode's solution, equilibrated with 95% O2 and 5% CO2 at 37 degrees C with a constant flow of 0.5 mL/min.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1988

Effect of alpha- and beta-adrenergic stimulation on atrial natriuretic peptide release in vitro.

The role of intracellular signals in the regulation of atrial natriuretic peptide (ANP) release was studied using the isolated left and right atria from a rat. The atria were perfused with Tyrode's solution, equilibrated with 95% O2-5% CO2 at 37 degrees C with a constant flow of 0.5 ml/min. Addition of epinephrine (10(-6) M), an alpha- and beta-agonist, to the perfusate induced the biphasic release of ANP from the right atrium without effect on the left. The initial peak (19.2 +/- 2.6 pg.min-1.ml-1) occurs 2-4 min after the administration of epinephrine, which lasted 4-6 min and returned to base line (10.4 +/- 1.1 pg.min-1.mg-1). The second peak (16.5 +/- 2.0 pg.min-1.ml-1) appeared 30-35 min after epinephrine administration and was sustained for 100 min, at which time the experiment was terminated. The first peak was stimulated by isoproterenol (10(-6) M), a beta-agonist, and blunted by propranolol (10(-6) M), a beta-antagonist. The second peak appeared following methoxamine (10(-6) M), an alpha-agonist, and could be suppressed by phentolamine (10(-6) M), an alpha-antagonist. These studies indirectly suggest that the adenosine 3',5'-cyclic monophosphate system and the inositol triphosphate system are involved in ANP secretion, with the former responsible for the initial rapid release and the latter maintaining the secretion.

Animals↗
PubMed1986

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac.

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.

Animals↗
PubMed1983

Abnormal left cardiac border due to an atherosclerotic coronary artery aneurysm.

A 57-year-old man had an aneurysm of the left anterior descending coronary artery that appeared as a bulge of the left cardiac border on plain chest roentgenograms. The aneurysm enlarged over a four-year period, and death resulted from myocardial infarction. The importance of recognizing this uncommon cause of an abnormal left cardiac border is stressed because further investigation by coronary angiography should be done before resection or bypass of the aneurysm.

Aneurysm↗