Biomedical subjects
Publications and source records attributed to E A Thompson.
We briefly review the major contribution of biometrics to genetics over the last century (population genetic models, familial correlations, segregation analysis, and gene mapping) and current areas of active research and then speculate about what problems will be tackled in the next century.
In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.
This study explored the intervention processes of an indicated prevention program for high-risk youth. It was hypothesized that intervention effects would be influenced by the direct and mediating effects of teacher social support on both peer group support and perceived personal control. In turn, personal control was hypothesized to mediate between teacher and peer group support, contributing to reductions in depression and suicide risk behaviors. The hypotheses were tested using a three-wave, longitudinal design incorporating data from preintervention, 5-month follow-up, and 10-month follow-up assessments of 106 high-risk youth divided into three comparison groups: two experimental, one control. For the two intervention groups, there were direct and/or indirect effects of teacher and peer group support on personal control, depression, and suicide risk behaviors. The general hypothesis that personal control mediates between support resources and reductions in depression and suicide risk behaviors received partial support across the study groups.
The abnormally high number of centrosomes found in many human tumor cells can lead directly to aneuploidy and genomic instability through the formation of multipolar mitotic spindles. To facilitate investigation of the mechanisms that control centrosome reproduction, a frog egg extract arrested in S phase of the cell cycle that supported repeated assembly of daughter centrosomes was developed. Multiple rounds of centrosome reproduction were blocked by selective inactivation of cyclin-dependent kinase 2-cyclin E (Cdk2-E) and were restored by addition of purified Cdk2-E. Confocal immunomicroscopy revealed that cyclin E was localized at the centrosome. These results demonstrate that Cdk2-E activity is required for centrosome duplication during S phase and suggest a mechanism that could coordinate centrosome reproduction with cycles of DNA synthesis and mitosis.
We used Monte Carlo Markov chain (MCMC) methods to analyze a quantitative trait, MAO level, and a discrete trait, Collaborative Study on the Genetics of Alcoholism (COGA) alcoholism. Segregation, linkage, and haplotype sharing were analyzed and effects of marker map features were examined. For MAO, modest signals were found on chromosomes 1 and 17 for raw data, and 15 for covariate-adjusted data. For alcoholism, a strong signal was found on chromosome 1 with modest signals on chromosomes 4 and 10.
This article explores the role of homoeopathy in supporting the patient with cancer. The author describes the homoeopathic approach and clinical research into its use in the cancer setting. A case history illustrates the practical application of the homoeopathic method and its success in managing symptoms of fatigue and anxiety. The author discusses potential problems using the approach. A wider discussion follows looking at why complementary therapies offer an important means to support the patient through different phases of the cancer diagnosis. There is an emphasis on the need for research to clarify whether conventional and complementary therapies can impact on survival and support wellbeing.
OBJECTIVE: To examine the validity of the Suicide Risk Screen (SRS) for identifying suicide-risk youths among potential high school dropouts. METHOD: Five hundred eighty-one potential dropouts, aged 14 to 20 years, participated in a 3-stage case identification protocol. A potential dropout pool was created in 7 schools; students, randomly selected, completed a questionnaire containing the SRS and participated in an assessment interview. Validity measures included Reynolds' Suicide Ideation Questionnaire (SIQ-JR) and 2 clinician rating scales, the Direct Suicide Risk (DSR) and Clinical Risk Assessment (CRA). RESULTS: Suicide-risk severity was significantly associated with categorization defined by the SRS criteria. SRS sensitivity ranged from 87% to 100%, specificity from 54% to 60%. Of 7 SRS elements, depression, suicidal ideation, and suicide threats predicted all validity measures. Suicide attempts predicted the DSR and CRA, but not Reynolds' SIQ-JR. Drug involvement, though relatively weaker, consistently predicted all validity measures. No additional psychosocial indicators improved the prediction of SIQ-JR or the DSR. Family support, likelihood of dropout, and risky behaviors, however, were additional predictors of the CRA ratings. CONCLUSIONS: The SRS is an effective and pragmatic method for identifying suicide-risk youths among potential dropouts in school settings.
In sea urchin zygotes and mammalian cells nuclear envelope breakdown (NEB) is not driven simply by a rise in cytoplasmic cyclin dependent kinase 1-cyclin B (Cdk1-B) activity; the checkpoint monitoring DNA synthesis can prevent NEB in the face of mitotic levels of Cdk1-B. Using sea urchin zygotes we investigated whether this checkpoint prevents NEB by restricting import of regulatory proteins into the nucleus. We find that cyclin B1-GFP accumulates in nuclei that cannot complete DNA synthesis and do not break down. Thus, this checkpoint limits NEB downstream of both the cytoplasmic activation and nuclear accumulation of Cdk1-B1. In separate experiments we fertilize sea urchin eggs with sperm whose DNA has been covalently cross-linked to inhibit replication. When the pronuclei fuse, the resulting zygote nucleus does not break down for >180 minutes (equivalent to three cell cycles), even though Cdk1-B activity rises to greater than mitotic levels. If pronuclear fusion is prevented, then the female pronucleus breaks down at the normal time (average 68 minutes) and the male pronucleus with cross-linked DNA breaks down 16 minutes later. This male pronucleus has a functional checkpoint because it does not break down for >120 minutes if the female pronucleus is removed just prior to NEB. These results reveal the existence of an activity released by the female pronucleus upon its breakdown, that overrides the checkpoint in the male pronucleus and induces NEB. Microinjecting wheat germ agglutinin into binucleate zygotes reveals that this activity involves molecules that must be actively translocated into the male pronucleus.
Human cytomegalovirus (HCMV) activates cyclin E/Cdk2, which regulates cell cycle progression in G1 and S phase of the cell cycle. HCMV activation of cyclin E/Cdk2 can be demonstrated in cells that are refractory to normal mitotic stimuli. This observation suggests that the virus has some means to overcome the stringent control on expression of cell cycle progression factors that is characteristic of cells in the G0 state. One of the mechanisms involved in activation of cyclin E/Cdk2 is the induction of cyclin E expression. We report here that HCMV induces cyclin E expression through a transcriptional mechanism. The cyclin E gene is activated by the HCMV 86-kDa immediate early gene product (IE86), which directly binds to nucleotide sequences within the cyclin E promoter. An IE86 DNA-binding mutant neither binds nor activates the cyclin E promoter. IE86-binding sites within the cyclin E promoter are required for IE86-mediated activation, and deletion of the IE86-binding site inhibits IE86 activation of the cyclin E promoter. We also demonstrate that mutation of the known E2F-binding sites in the cyclin E promoter does not block activation by HCMV or IE86. These data provide a molecular mechanism for HCMV induction of cyclin E and represent the first report of IE86 directly binding to a cellular promoter.
Transforming growth factor-beta 1 (TGF-beta1) arrests intestinal epithelial cells (RIE-1 and IEC-6) in the G1 phase of the cell cycle and inhibits cyclin D1 expression. This report describes experiments designed to elucidate the mechanism of cyclin D1 inhibition and to determine whether inhibition of cyclin D1 expression is the cause, rather than the result, of TGF-beta1-mediated cell cycle arrest. TGF-beta1 inhibition of IEC-6 cell proliferation was associated with a decrease in the abundance of cyclin D1/Cdk4 complexes and a corresponding decrease in Cdk4-dependent phosphorylation of the retinoblastoma protein. Metabolic labeling studies indicated that TGF-beta1 inhibited cyclin D1 synthesis without altering the rate of cyclin D1 protein degradation. Cyclin D1 antisense oligonucleotides blocked serum-stimulated induction of cyclin D1 and DNA synthesis, whereas cyclin D1 sense oligonucleotides had no effect. RIE-1 cells were engineered to overexpress human cyclin D1 under the control of a tetracycline-repressible promoter. These cells entered S phase in the presence of TGF-beta1 only when human cyclin D1 was derepressed by the withdrawal of tetracycline. These data indicate that TGF-beta1 inhibits the synthesis of cyclin D1 in gut epithelial cells and that this inhibition is the cause, rather than the result, of TGF-beta1-mediated arrest of intestinal epithelial cell proliferation.
BACKGROUND: Previous studies suggest that responsiveness is impaired during complex partial seizures (CPS) and pseudoseizures (PS); however, to our knowledge, there has been no systematic comparison using both response and memory testing. OBJECTIVE: To compare CPS with PS using ictal cognitive assessment (ICA) of responsiveness and memory. PATIENTS AND METHODS: We used a nonautomated method of ICA by bedside observers, consisting of family members and staff, during video electroencephalographic monitoring to test responsiveness and memory during the ictal phase in 245 events. We assessed the adequacy of testing and compared the testing results in 31 patients during CPS and 13 patients during PS. RESULTS: The ictal presentation of a command was successful in 58% of the events. The ictal presentation of at least 2 memory items with testing for recall after orientation was adequate in 57% of events. Impaired responsiveness was shown during both CPS and PS. However, some response was detected during 48% of PS compared with 18% of CPS (P<.01). Memory items were recalled during 63% of PS but during only 4% of CPS (P<.001). The International Classification of Epileptic Seizures remained useful, but in 11 events (8%), distinguishing complex from simple partial seizures was difficult. Recall of various types of stimuli (aural-verbal vs visual-pictorial) during ICA did not correlate with the side or location of the seizure focus, but this may have been confounded by the rarity of any memory recall during CPS. CONCLUSIONS: Ictal cognitive assessment by bedside observers is practical and provides the interaction necessary for properly classifying seizures; ICA, especially memory, may help to distinguish CPS from PS.
Analysis of age of onset is a key factor in the segregation and linkage analysis of some complex genetic traits. Previous work in the genetics literature has used parametric distributional assumptions on age of onset. In this paper, a Cox model with latent major gene effects is used: a semiparametric model with unspecified baseline hazard. A Monte Carlo EM procedure is used to obtain maximum likelihood estimates. Markov chain Monte Carlo is used to realize genotypic configurations from the posterior distribution given the current model and the observed data, and these genotypic configurations are used to estimate the expectations in the EM algorithm. Simulated data sets indicate that the parameters can be estimated well, and one real data set shows the practical applicability of the proposed method.
Genetic linkage studies based on pedigree data have limited resolution, because of the relatively small number of segregations. Disequilibrium mapping, which uses population associations to infer the location of a disease mutation, provides one possible strategy for narrowing the candidate region. The coalescent process provides a model for the ancestry of a sample of disease alleles, and recombination events between disease locus and marker may be placed on this ancestral phylogeny. These events define the recombinant classes, the sets of sampled disease copies descending from the meiosis at which a given recombination occurred. We show how Monte Carlo generation of the recombinant classes leads to a linkage likelihood for fine-scale mapping from disease haplotypes. We compare single-marker disequilibrium mapping with interval-disequilibrium mapping and discuss how the approach may be extended to multipoint-disequilibrium mapping. The method and its properties are illustrated with an example of simulated data, constructed to be typical of fine-scale mapping of a rare disease in the Japanese population. The method can take into account known features of population history, such as changing patterns of population growth.
Human cytomegalovirus is a herpesvirus that induces numerous cellular processes upon infection. Among these are activation of cyclin-dependent kinase 2, which regulates cell cycle progression in G1 and S phase. We report here that inhibition of cellular Cdk2 activity blocks HCMV replication. Inhibition of Cdk2 activity by roscovitine inhibits HCMV DNA synthesis, production of infectious progeny, and late antigen expression in infected cells in a dose-dependent manner. HCMV replication is also inhibited by the expression of a Cdk2 dominant negative mutant, whereas expression of wild-type Cdk2 has no effect on viral replication. These data indicate that activation of cellular Cdk2 is necessary for HCMV replication.
Our objective was to infer the genetic model for the quantitative traits using a variety of methods developed in our group. Only a single data set was analyzed in any one analysis, although some comparison between data sets was made. In addition, the simulated model was not known during the course of the analysis. Basic modeling and segregation analyses for the five quantitative traits was followed by several simple genome scans to indicate areas of interest. A Markov chain Monte Carlo (MCMC) multipoint quantitative trait locus (QTL) mapping approach was then used to estimate the posterior probabilities of linkage of QTL to each chromosome simultaneously with trait model parameters, and to further localize the genes. Comparisons between the nuclear family and pedigree data sets indicated a greater power for QTL detection and mapping with the pedigree data sets. Even with the pedigree data, however, precise localization of the QTL did not appear to be possible using single replicate data sets. Two of the three genes with effects on trait Q1 were detected by the MCMC method.
The intestinal epithelium is maintained by a balance between proliferation, differentiation and death that occurs as cells migrate up the crypt-villus axis. Cell cycle regulators such as cyclins, cyclin-dependent kinases (Cdks) and Cdk inhibitory proteins are expressed in a distinct pattern along the crypt-villus structure, suggesting their role in controlling intestinal cells. This is supported by observations that these cell cycle proteins are regulated by growth factors, nutrients and cell-cell contact in cultured intestinal epithelial cells. One of the key regulators of intestinal cell proliferation and differentiation is transforming growth factor-beta, which is expressed in the gut epithelium.
BACKGROUND: Hepatic regeneration after partial hepatectomy (PH) is characterized by a synchronous induction of normally quiescent hepatocytes to reenter the cell cycle, leading to a complete restoration of hepatic mass. Cell cycle progression requires activation of cyclin-dependent kinases (Cdks) that are regulated by cyclins and Cdk inhibitors. METHODS: Protein expression of the cyclins (D-type and E), Cdks (Cdk2 and 4), and Cdk inhibitors (p21 and p27) was measured by Western blot after SHAM operation or PH in F344 rats. In addition, Cdk2-associated kinase activity was measured. RESULTS: Rapid induction of D-type and E cyclins, as well as their catalytic partners, Cdk2 and Cdk4, occurred after PH in rats. Complexes containing cyclin E and Cdk2 assembled in the regenerating liver, leading to increased Cdk2-associated kinase activity. The regenerating liver returned to preresection weight by day 7, at which time the Cdk2 activity also returned to SHAM levels. Biphasic induction of the Cdk inhibitor p21 was observed; the first peak occurred as early as 6 hours after PH, with a subsequent peak in expression occurring at 24 to 72 hours after PH. CONCLUSIONS: Taken together, these data support the concept that cyclins, Cdks, and Cdk inhibitors regulate cell cycle progression in the regenerating liver. In addition, the induction of p21 at two time points suggests that this protein may regulate both early proliferation and subsequent inhibition of hepatocyte regeneration.
Human cytomegalovirus (HCMV) stimulates numerous cellular pathways upon infection. One of these pathways involves activation of cyclin E/Cdk2. Recent reports have demonstrated that Cdk2 is retained in the cytoplasm of cells arrested in GO by serum deprivation, sequestered from its regulatory subunit cyclin E which is located within the nucleus. Cdk2 rapidly enters the nucleus and becomes active upon stimulation of these cells with serum growth factors. The ability of HCMV to activate cyclin E/Cdk2 in both serum-arrested cells and contact-inhibited cells suggests that HCMV infection may also result in the translocation of Cdk2 into the nucleus. In this report, we demonstrate that Cdk2 is sequestered in the cytoplasm of cells arrested in GO by contact inhibition, as well as those arrested by serum deprivation. HCMV infection results in translocation of Cdk2 from the cytoplasm into the nucleus within 24 h of infection, both in serum-arrested and contact-inhibited cells.