Search PubMed⌕ Search

Biomedical subjects

David A Somers

Publications and source records attributed to David A Somers.

11 recordsLinked to original sources
PubMed2006

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci.

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.

Amino Acid Sequence↗
PubMed2006

UDP-sugar pyrophosphorylase is essential for pollen development in Arabidopsis.

Arabidopsis UDP-sugar pyrophosphorylase (AtUSP) is a broad substrate enzyme that synthesizes nucleotide sugars. The products of the AtUSP reaction can act as precursors for the synthesis of glycolipids, glycoproteins, and cell wall components including pectin and hemicellulose. AtUSP has no close homologs in Arabidopsis and its biological function has not been clearly defined. We identified two T-DNA insertional mutant lines for AtUSP, usp-1 and usp-2. No homozygous individuals were identified and progeny from plants heterozygous for usp-1 or usp-2 showed a 1:1 segregation ratio under selection. Despite decreased levels of both AtUSP transcript and USP activity (UDP-GlcA-->GlcA-1-P), heterozygous plants were indistinguishable from wild type at all stages of development. Reciprocal test crosses indicated the source of the segregation distortion was lack of transmission through the male gametophyte. Analysis of pollen tetrads from usp-1 in the quartet background revealed a 2:2 ratio of normal:collapsed pollen grains. The collapsed pollen grains were not viable as determined by Alexander's viability and DAPI staining, and pollen germination tests. The pollen phenotype of usp-1 was complemented by transformation of usp-1 with the AtUSP cDNA sequence. Surface and ultrastructural analyses of pollen from wild-type and usp mutants demonstrated that the mutation had no apparent effect on the outer wall (exine) but prevented the synthesis of the pectocellulosic inner wall (intine). Evidence presented here shows that AtUSP has a critical role in pollen development.

Alleles↗
PubMed2006

Soybean (Glycine max) transformation using mature cotyledonary node explants.

Agrobacterium tumefaciens-mediated transformation of soybeans has been steadily improved since its development in 1988. Soybean transformation is now possible in a range of genotypes from different maturity groups using different explants as sources of regenerable cells, various selectable marker genes and selective agents, and different A. tumefaciens strains. The cotyledonary-node method has been extensively investigated and across a number of laboratories yields on average greater than 1% transformation efficiency (one Southern-positive, independent event per 100 cotyledonary-node explants). Continued improvements in the cotyledonary-node method concomitant with further increases in transformation efficiency will enhance broader adoption of this already productive transformation method for use in crop improvement and functional genomics research efforts.

Agrobacterium tumefaciens↗
PubMed2006

Soybean (Glycine max) transformation using immature cotyledon explants.

Agrobacterium tumefaciens-mediated transformation of soybeans can be accomplished using immature zygotic cotyledons as target tissues providing an alternate explant to embryogenic tissue cultures, proliferating meristems, and cotyledonary nodes. The immature cotyledon method includes direct induction of transgenic somatic embryos from the explant plated on selective media after cocultivation, followed by maturation and regeneration of individual somatic embryos into whole plants. Although this method has been improved to be simple, rapid, reproducible, and applicable to a range of cultivars in different maturity groups, the transformation efficiency (Southern-positive, independent plants produced per 100 immature cotyledon explants) is 1.7% and needs to be further increased to make this a robust soybean transformation system. Further refinements of cocultivation conditions, tissue culture, and selection of regenerated transgenic plants will probably result in increases in transformation efficiency.

Agrobacterium tumefaciens↗
PubMed2004

Transgene integration in plants: poking or patching holes in promiscuous genomes?

Transgene integration in plants transformed by either Agrobacterium or direct DNA delivery methods occurs through illegitimate recombination (IR). The precise mechanism(s) for IR-mediated transgene integration and the role of host double-strand break repair enzymes remain unknown. A recent wealth of sequenced transgene loci and investigations aimed at genetically dissecting transgene integration mechanism(s) have provided new insights into the process.

DNA↗
PubMed2004

T-DNA locus structure in a large population of soybean plants transformed using the Agrobacterium-mediated cotyledonary-node method.

Designing transformation experiments for either functional genomics or crop improvement requires knowledge of the transgene locus structure, number, transmission and expression resulting from a specific transformation method. We recently reported an improvement to the soybean [Glycine max (L.) Merrill] cotyledonary-node transformation method that resulted in the efficient production of transgenic plants. To characterize the transgene loci resulting from this method, we analysed 270 independent T0 plants and 95 randomly selected T1 progenies for T-DNA locus complexity using Southern analysis. The lines were transformed with Agrobacterium tumefaciens strains LBA4404 or EHA105 carrying the binary plasmids pGPTV, pTOK233, pCAMBIA1303 or pCAMBIA1309, and regenerated in medium supplemented with or without silver nitrate (AgNO3). Analysis in the T0 generation showed that the number of hpt-hybridizing fragments per plant ranged from 1-15, with 31.5% of the lines having a single hpt-hybridizing fragment. Each primary soybean transformant had, on average, 2.0 unlinked transgene loci and that half of the segregating loci in the T1 progenies were single, simple T-DNA insertions. Of the loci containing multiple T-DNA fragments, a low frequency had tandem and inverted repeat T-DNA structures. Integration of binary plasmid backbone sequences occurred in 37% of primary transformants. A. tumefaciens strain, binary plasmid and thiol treatment had no significant effect on transgene locus structure, numbers or expression. Interestingly, exposure of soybean explants to AgNO3 throughout shoot induction and elongation increased T-DNA locus complexity in the primary transformants and decreased silencing of gusA expression in the T1 generation.

Journal Article↗
PubMed2004

Expression of UDP-glucose dehydrogenase reduces cell-wall polysaccharide concentration and increases xylose content in alfalfa stems.

The primary cell-wall matrix of most higher plants is composed of large amounts of uronic acids, primarily D-galacturonic acid residues in the backbone of pectic polysaccharides. Uridine diphosphate (UDP)-glucose dehydrogenase is a key enzyme in the biosynthesis of uronic acids. We produced transgenic alfalfa (Medicago sativa) plants expressing a soybean UDP-glucose dehydrogenase cDNA under the control of two promoters active in alfalfa vascular tissues. In initial greenhouse experiments, enzyme activity in transgenic lines was up to seven-fold greater than in nontransformed control plants; however, field-grown transgenic plants had only a maximum of 1.9-fold more activity than the control. Cell-wall polysaccharide content was lower and Klason lignin content was higher in transgenics compared to the nontransformed control. No significant increase in pectin or uronic acids in the polysaccharide fraction was observed in any line. Xylose increased 15% in most transgenic lines and mannose concentration decreased slightly in all lines. Because of the complexity of pectic polysaccharides and sugar biosynthesis, it may be necessary to manipulate multiple steps in carbohydrate metabolism to alter the pectin content of alfalfa.

Biomass↗
PubMed2002

Efficient soybean transformation using hygromycin B selection in the cotyledonary-node method.

The efficiency of soybean [Glycine max (L.) Merrill] transformation was significantly increased from an average of 0.7% to 16.4% by combining strategies to enhance Agrobacterium tumefaciens-mediated T-DNA delivery into cotyledonary-node cells with the development of a rapid, efficient selection protocol based on hygromycin B. Wounded cotyledonary-node explants were inoculated with A. tumefaciens carrying either a standard-binary or super-binary plasmid and co-cultivated in the presence of mixtures of the thiol compounds, L-cysteine, dithiothreitol, and sodium thiosulfate. Transformed shoots began elongating only 8 weeks after co-cultivation. Southern analysis confirmed integration of the T-DNA into genomic DNA and revealed no correlation between the complexity of the integration pattern and thiol treatment applied at co-cultivation. All T(0) plants were fertile and the majority of the lines transmitted the beta-glucuronidase (GUS) phenotype in 3:1 or 15:1 ratios to their progenies.

Agrobacterium tumefaciens↗
PubMed2002

Complex transgene locus structures implicate multiple mechanisms for plant transgene rearrangement.

To more fully characterize the internal structure of transgene loci and to gain further understanding of mechanisms of transgene locus formation, we sequenced more than 160 kb of complex transgene loci in two unrelated transgenic oat (Avena sativa L.) lines transformed using microprojectile bombardment. The transgene locus sequences from both lines exhibited extreme scrambling of non-contiguous transgene and genomic fragments recombined via illegitimate recombination. A perfect direct repeat of the delivered DNA, and inverted and imperfect direct repeats were detected in the same transgene locus indicating that homologous recombination and synthesis-dependent mechanism(s), respectively, were also involved in transgene locus rearrangement. The most unexpected result was the small size of the fragments of delivered and genomic DNA incorporated into the transgene loci via illegitimate recombination; 50 of the 82 delivered DNA fragments were shorter than 200 bp. Eleven transgene and genomic fragments were shorter than the DNA lengths required for Ku-mediated non-homologous end joining. Detection of these small fragments provided evidence that illegitimate recombination was most likely mediated by a synthesis-dependent strand-annealing mechanism that resulted in transgene scrambling. Taken together, these results indicate that transgene locus formation involves the concerted action of several DNA break-repair mechanisms.

Avena↗