Search PubMed⌕ Search

Biomedical subjects

Daniel Coman

Publications and source records attributed to Daniel Coman.

5 recordsLinked to original sources

A nuclear magnetic resonance investigation of the energetics of basepair opening pathways in DNA.

The opening of basepairs plays a key role in DNA replication and transcription, and in the action of DNA repair and modification enzymes. In this article, we have used proton exchange to define the energetics of the pathways for basepair opening in two DNA 17-mer duplexes. The rates of exchange of imino protons with solvent protons were measured by NMR spectroscopy for each DNA duplex, as a function of the concentration of exchange catalyst and of temperature. The measurements provided the rates and the equilibrium constants of the opening reactions for individual basepairs at different temperatures. These temperature dependences were used to calculate the enthalpies and the free energies of the barrier to opening and of the open state for each basepair. The results reveal the existence of three distinct patterns of enthalpy changes in the opening reactions. The patterns differ from each other in the location of the kinetic opening barrier relative to the open state. Neighboring bases, which are one or more positions removed from the opening basepair, influence the enthalpic pattern of the opening pathway. The free energies of the opening barriers are found to be linearly related to the free energies of the open state. This correlation is analyzed in terms of rate-equilibrium free energy relationships previously observed in other systems, and suggests that the transition state in the opening reaction is closer to the native closed state of the basepair than to its open state.

Ammonia↗

Base pair opening in three DNA-unwinding elements.

DNA-unwinding elements are specific base sequences that are located in the origin of DNA replication where they provide the start point for strand separation and unwinding of the DNA double helix. In the present work we have obtained the first characterization of the opening of individual base pairs in DNA-unwinding elements. The three DNA molecules investigated reproduce the 13-mer DNA-unwinding elements present in the Escherichia coli chromosome. The base sequences of the three 13-mers are conserved in the origins of replication of enteric bacterial chromosomes. The exchange of imino protons with solvent protons was measured for each DNA as a function of the concentration of exchange catalyst using nuclear magnetic resonance spectroscopy. The exchange rates provided the rates and the equilibrium constants for opening of individual base pairs in each DNA at 20 degrees C. The results reveal that the kinetics and energetics of the opening reactions for AT/TA base pairs are different in the three DNA-unwinding elements due to long range effects of the base sequence. These differences encompass the AT/TA base pairs that are conserved in various bacterial genomes. Furthermore, a qualitative correlation is observed between the kinetics and energetics of opening of AT/TA base pairs and the location of the corresponding DNA-unwinding element in the origin of DNA replication.

Ammonia↗

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Base Pairing↗

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors.

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.

DNA↗

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.

Base Pairing↗