Biomedical subjects
Publications and source records attributed to D V Goeddel.
DNA coding for human growth hormone was constructed by using chemically synthesised DNA in conjunction with enzymatically prepared cDNA. This 'hybrid' gene was expressed in Escherichia coli under the control of the lac promoter. A polypeptide was produced having the size and immunological properties characteristic of mature human growth hormone.
Explore the source record for details and available documents.
Synthetic genes for human insulin A and B chains were cloned separately in plasmid pBR322. The cloned synthetic genes were then fused to an Escherichia coli beta-galactosidase gene to provide efficient transcription and translation and a stable precursor protein. The insulin peptides were cleaved from beta-galactosidase, detected by radioimmunoassay, and purified. Complete purification of the A chain and partial purification of the B chain were achieved. These products were mixed, reduced, and reoxidized. The presence of insulin was detected by radioimmunoassay.
Explore the source record for details and available documents.
A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.
Nucleotide analogs were substituted for unmodified nucleotides at specific sites in the lac operator sequence by a combination of chemical and enzymatic procedures. The nitrocellulose filter assay was used to study the interactions of these modified operators with wild-type (SQ) and tight-binding (QX86) lac repressors. These studies implicate directly the 5 methyl of thymine and the 2 amino of guanine as important operator-repressor contact sites. Furthermore, when these findings are combined with published results from other laboratories, a model for the lac operator-lac repressor interaction can be derived. Two important postulates follow from this model. (i) The repressor interacts at specific and defined sites with the N7 of guanine, the 5 methyl of thymine, the 2 amino of guanine, and the central major groove of the operator. (ii) The repressor binds to one side of the operator.
The chemical synthesis of lactose operator DNA segments is described. The 31-base-paired duplex contains the DNA recognized by lac repressor protein and twofold rotationally symmetric base pairs on either side of the tight binding region. The synthesis includes the deoxyoligonucleotides d(T-G-T-G-G), d(A-A-T-T-G-T-G-A-G), d(C-G-G-A-T-A-A-C-A-A-T-T), d(T-C-A-C-A), d(T-G-T-G-A-A-A-T-T-G-T), d(T-A-T-C-C-G-C-T-C-A-C), and d(A-A-T-T-C-C-A-C-A). These deoxyoligonucleotides were characterized by two-dimensional sequencing techniques, paper chromatography, and thin-layer chromatography.
The T4 polynucleotide ligase catalyzed joining of six chemically synthesized deoxypolynucleotides corresponding to lactose operator DNA has been investigated. Joining was studied using various combinations of segments. Joining reactions involving multiple sites and the formation of duplex operator DNA were complete in a few hours. Joining reactions involving a single site and the formation of only one strand of operator DNA required several days and repeated annealing in order to go to completion. These studies have permitted the synthesis on a preparative scale (several nanomoles) of operator duplexes and operator single strands.
Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.
The nitrocellulose filter assay was used to study the interactions of wild-type (SQ) and tight-binding (QX86) lac repressors with synthetic lac operators 21 and 26 base pairs long. The repressor binding properties of both operators were very similar, indicating that both contain the same specific repressor recognition sites. The repressor-operator association rate constants (k(a)) were more sensitive than dissociation rate constants (k(d)) to changes in ionic strength. The responses of both k(a) and k(d) to ionic strength were relatively small compared to the effects previously observed with lambdah80dlac as operator DNA. These results suggest that under natural conditions there are electrostatic interactions between lac repressor and DNA regions outside of the 26 base pair operator sequence. Association rate constants for SQ repressor with either operator are higher than have been predicted for diffusion-limited reactions. We postulate that long-range electrostatic attractions between repressor and operator accelerate the association reaction. The presence of nonoperator DNA decreased association rate constants, the effect being more noticeable at an ionic strength of 0.05 M than at 0.20 M. Nonoperator DNA reduced k(a) values for associations involving QX86 repressor to a greater extent than for those with SQ repressor. The two types of repressors also had different rate constants for interactions with synthetic operators. The values for k(a) and k(d) were both higher with SQ repressor than with QX86 repressor. However, the rate constants were more sensitive to ionic strength when the repressor used was QX86.
Chemically synthesized lactose operator DNA was tested for binding with lactose repressor protein. These operator DNAs were found to (1) bind specifically to lactose SQ repressor as measured by release of binding with the inducing ligand isopropyl-beta-D-thiogalactoside, (2) have dissociation half-lives of 37 seconds (21 base-paired duplex) and 46 seconds (26 base-paired duplex) and (3) have dissociation half-lives with x86 repressor of 9 minutes (21 base-paired duplex) and 18 minutes (26 base paired duplex). Modified operators containing 5-bromodeoxyuridine and deoxyuridine at specific sites were also prepared. These analogs bound both repressors about as tightly as the wild type sequence.
Three site specific deoxyuridine analogs of lac operator were tested for binding with wild type (SQ) and tight binding (QX86) lac repressors. Insertion of uracil for thymine at site 13 (our nomenclature) significantly reduced the dissociation half-life of QX86 repressor for lac operator DNA (21 vs 1.2 min). Two other sites (6 and 7) are affected to a much lesser extent.