Search PubMed⌕ Search

Biomedical subjects

D Navarro

Publications and source records attributed to D Navarro.

At least 19 recordsLinked to original sources

Effect of highly active anti-retroviral therapy and hepatitis C virus co-infection on serum levels of pro-inflammatory and immunoregulatory cytokines in human immunodeficiency virus-1-infected individuals.

This study aimed to determine the effect of highly active anti-retroviral therapy (HAART) and hepatitis C virus (HCV) co-infection on peripheral levels of interleukin (IL)-2, IL-10, IL-12 (p70), IL-18 and soluble tumour necrosis factor receptor type II (sTNFRII). Serum levels were monitored for a 1-year period in 25 patients infected with human immunodeficiency virus-1 (HIV-1) who were naive for HAART at the initiation of the study, and in four HIV-1-infected long-term non-progressors. Serum levels of both IL-18 and sTNFRII at baseline were significantly higher in HIV-1-infected patients than in controls. Baseline levels of IL-18 and sTNFRII were not significantly different in long-term non-progressors compared with the other patients. HCV co-infected patients had significantly higher levels of IL-18 and sTNFRII at each time-point compared with patients who were not co-infected with HCV. Irrespective of HCV status, response to HAART resulted in a significant decrease in the levels of both IL-18 and sTNFRII, particularly among patients who achieved HIV viral suppression, but the net decrease observed at the end of follow-up was lower in patients co-infected with HCV. No information was obtained from IL-2, IL-10 and IL-12 (p70) measurements. The data suggest that analysis of serum levels of IL-18 and sTNFRII may be a valuable tool for evaluating the response to HAART, and perhaps for assessing the degree of immune restoration achieved by HAART responders. The results also highlight the relevance of considering the HCV infection status of HIV-1-infected patients in order to avoid misinterpretation of IL-18 and sTNFRII measurements.

Adult↗

Prophylaxis of early bacterial infections after autologous peripheral blood stem cell transplantation (PBSCT): a matched-pair study comparing oral fluoroquinolones and intravenous piperacillin-tazobactam.

The safety and efficacy of early bacterial prophylaxis with piperacillin-tazobactam were prospectively evaluated in 51 autologous peripheral blood stem cell transplantation (PBSCT) recipients. The results were compared with those obtained in 51 control patients receiving oral fluoroquinolones in a retrospective matched-pair control study. Overall, 76% of the study group and 98% of the control group developed at least one febrile episode during neutropenia (P=0.002). Time from neutropenia to the first febrile episode (FFE) was significantly longer in the study group than in the control group (P=0.04). Once a febrile episode appeared, the duration of fever was significantly longer in cases than in controls (median of 5 and 2 days respectively, P<0.001), and led to a more frequent use of empirical amphotericin B (AmB), not statistically significant (P=0.13). However, the total time of antibiotic administration was significantly greater in the control than in the study group (P=0.05). The duration of AmB treatment shows a trend toward a longer duration in the control than in study group (P=0.2). Overall, 86% of the Gram-positive bacteremia and 85% of the Gram-negative bacteria were susceptible to the tested antibiotics. Our study suggests that a subgroup of patients could benefit from prophylaxis with piperacillin-tazobactam without increasing toxicity or bacterial resistance.

Adolescent↗

Gradient of sodium current across the left ventricular wall of adult rat hearts.

1. Gradients of ion channels across the left ventricular (LV) wall have been well characterized and it has been shown that disruption of such gradients leads to altered rates of repolarization across the wall, which is associated with the generation of arrhythmias. 2. We have hypothesized that a transmural gradient of I(Na) is present and have directly measured this current in adult rat myocytes isolated from both the epicardial and endocardial layers of the left ventricle. Currents were also recorded in right ventricular (RV) myocytes for comparison. 3. Peak inward I(Na) currents, at -30 mV, were -49.7 +/- 2.5 pA pF(-1) (n = 22), -32.9 +/- 3.2 pA pF(-1) (n = 16) and -49.7 +/- 3.7 pA pF(-1) (n = 24) for RV, LV epicardial and LV endocardial myocytes, respectively. No differences in the voltage dependence of inactivation, the voltage dependence of steady-state inactivation, or reactivation were reported. 4. Our results demonstrate that a gradient of sodium current density is present across the LV wall of adult rat hearts.

Age Factors↗

Neutral endopeptidase inhibits neuropeptide-mediated transactivation of the insulin-like growth factor receptor-Akt cell survival pathway.

G-protein coupled receptor (GPCR) agonists such as neuropeptides activate the insulin-like growth factor-1 receptor (IGF-IR) or the serine-threonine protein kinase Akt, suggesting that neuropeptides-GPCR signaling can cross-communicate with IGF-IR-Akt signaling pathways. Neutral endopeptidase 24.11 (NEP) is a cell-surface peptidase that cleaves and inactivates the neuropeptides endothelin-1 (ET-1) and bombesin, which are implicated in progression to androgen-independent prostate cancer (PC). We investigated the mechanisms of NEP regulation of neuropeptide-mediated cell survival in PC cells, including whether neuropeptide substrates of NEP induce phosphorylations of IGF-IR and Akt in PC cells. Western analyses revealed ET-1 and bombesin treatment induced phosphorylation of IGF-IRbeta and Akt independent of IGF-I in TSU-Pr1, DU145, and PC-3 PC cells, which lack NEP expression, but not in NEP-expressing LNCaP cells. Recombinant NEP and induced NEP expression in TSU-Pr1 cells using a tetracycline-repressive expression system inhibited ET-1-mediated phosphorylation of IGF-IRbeta and Akt, and blocked the protective effects of ET-1 against apoptosis induced by serum starvation. Incubation of TSU-Pr1 cells with specific kinase inhibitors together with ET-1 or bombesin showed that IGF-IR activation is required for neuropeptide-induced Akt phosphorylation, and that neuropeptide-induced Akt activation is predominantly mediated by Src and phosphatidylinositol 3-kinase but not by mitogen-activated protein kinase or protein kinase C. These data show that the neuropeptides ET-1 and bombesin stimulate ligand-independent activation of the IGF-IR, which results in Akt activation, and that this cross-communication between GPCR and IGF-IR signaling is inhibited by NEP.

Bombesin↗

Longitudinal analysis of human cytomegalovirus glycoprotein B (gB)-specific and neutralizing antibodies in AIDS patients either with or without cytomegalovirus end-organ disease.

Serum neutralizing and glycoprotein B (gB)-specific antibody levels were monitored prospectively in AIDS patients who either did or did not develop human cytomegalovirus (HCMV) end-organ disease, to delineate further the role of antibodies in protecting against HCMV disease. Antibody levels declined substantially (at least 4-fold) only in patients who developed HCMV disease; this decline in turn occurred concurrently with antigenemia. Nevertheless, AIDS patients who remained free of HCMV disease and did not become antigenemic during the follow-up period maintained stable levels of serum antibodies, with only minor fluctuations. The impact of HAART on the levels of functional anti-HCMV antibodies was investigated in a number of AIDS patients. Serum levels and kinetics of gB and neutralizing antibodies did not differ significantly between patients who responded biologically and virologically to therapy and those who failed to respond. In addition, CD4 + cell counts and HIV viral RNA levels did not correlate with anti-HCMV antibody titers.

AIDS-Related Opportunistic Infections↗

Evidence of a new biotransformation pathway of p-coumaric acid into p-hydroxybenzaldehyde in Pycnoporus cinnabarinus.

Pycnoporus cinnabarinus MUCL39533 was shown to be able to convert p-coumaric acid into p-hydroxybenzaldehyde, a component of high organoleptic note present in natural vanilla aroma. Use of phospholipid-enriched medium led to high-density cultures of P. cinnabarinus, since dry mycelial biomass was increased three-fold as compared to glucose medium. In the presence of phospholipids, 155 mg l(-1) p-hydroxybenzaldehyde was produced as the major compound on culture day 13 with a molar yield of 26%. The degradation pathways of p-coumaric acid were investigated. Based on the different metabolites identified, an oxidative side-chain degradation pathway of p-coumaric acid conversion to p-hydroxybenzoic acid was suggested. This acid was further reduced to p-hydroxybenzaldehyde and p-hydroxybenzyl alcohol, or hydroxylated and reduced to protocatechyl derivatives. Additionally, a reductive pathway of p-coumaric acid with 3-(4-hydroxyphenyl)-propanol as the terminal product occurred.

Agaricales↗

Shifting the biotransformation pathways of L-phenylalanine into benzaldehyde by Trametes suaveolens CBS 334.85 using HP20 resin.

AIMS: The biotransformation of L-phenylalanine into benzaldehyde (bitter almond aroma) was studied in the strain Trametes suaveolens CBS 334.85. METHODS AND RESULTS: Cultures of this fungus were carried out in the absence or in the presence of HP20 resin, a highly selective adsorbent for aromatic compounds. For the identification of the main catabolic pathways of L-phenylalanine, a control medium (without L-phenylalanine) was supplemented with each of the aromatic compounds, previously detected in the culture broth, as precursors. Trametes suaveolens CBS 334.85 was shown to biosynthesize benzyl and p-hydroxybenzyl derivatives, particularly benzaldehyde, and large amounts of 3-phenyl-1-propanol, benzyl and p-hydroxybenzyl alcohols as the products of both cinnamate and phenylpyruvate pathways. CONCLUSION: The addition of HP20 resin, made it possible to direct the catabolism of L- phenylalanine to benzaldehyde, the desired target compound, and to trap it before its transformation into benzyl alcohol. In these conditions, benzaldehyde production was increased 21-fold, from 33 to 710 mg l-1 corresponding to a molar yield of 31%. SIGNIFICANCE AND IMPACT OF THE STUDY: These results showed the good potential of Trametes suaveolens as a biotechnological agent to synthesize natural benzaldehyde which is one of the most important aromatic aldehydes used in the flavour industry.

Benzaldehydes↗

Qualitative plasma PCR assay (AMPLICOR CMV test) versus pp65 antigenemia assay for monitoring cytomegalovirus viremia and guiding preemptive ganciclovir therapy in allogeneic stem cell transplantation.

The performances of a commercially available qualitative plasma PCR assay (AMPLICOR CMV test; Roche Diagnostics) and the pp65 antigenemia assay (AG) were evaluated for the monitoring of cytomegalovirus (CMV) viremia in 43 allogeneic stem cell transplant recipients. In addition, the suitabilities of both assays for triggering the initiation of preemptive ganciclovir therapy were assessed. A total of 37 CMV viremic episodes were detected in 28 patients. Positivity of plasma PCR testing in one or more consecutive specimens was the only marker of CMV viremia in 18 of the 37 episodes (PCR positive and AG negative, n = 50 specimens). Five episodes were diagnosed on the basis of a single positive AG result (AG positive and PCR negative, n = 5 specimens); both assays were eventually positive (PCR positive and AG positive, n = 27 specimens) for 14 viremic episodes; for these episodes, conversion of the PCR assay result to a positive result occurred an average of 1 week before conversion of the AG result. Overall, the concordance between the two methods was 90%, and the sensitivities of the plasma PCR assay and AG for the detection of CMV viremic episodes were 86.5 and 51.3%, respectively. Two patients who tested positive by both assays simultaneously progressed to CMV end-stage organ disease, despite the initiation of preemptive ganciclovir therapy. Conversion of the AG result to a negative result upon administration of preemptive ganciclovir therapy occurred a median of 7.5 days earlier than conversion of the plasma PCR assay result. Nineteen of the 28 patients with CMV viremia received AG-guided preemptive ganciclovir therapy; had the positivity of the plasma PCR assay triggered the initiation of preemptive therapy, 9 additional patients would have been unnecessarily treated since none of them developed CMV end-stage organ disease. Although the AMPLICOR CMV assay is more sensitive than AG, the latter appears to be more suitable both for guiding the initiation of preemptive therapy and for monitoring a patient's response to antiviral therapy.

Antiviral Agents↗

Tumor-suppressive effects of neutral endopeptidase in androgen-independent prostate cancer cells.

Expression of neutral endopeptidase (NEP) 24.11 is diminished in metastatic, androgen-independent prostate cancers (PCs; C. N. Papandreou et al., NAT: MED:, 4: 50--57, 1998). To determine the effects on androgen-independent PC cells of overexpressing cell-surface NEP, an inducible tetracycline-regulatory gene expression system was used to stably introduce and express the NEP gene in androgen-independent TSU-Pr1 cells generating WT-5 cells, which expressed high levels of enzymatically active NEP protein when cultured in the absence of tetracycline. TN12 cells, which contain the identical vectors without the NEP gene and do not express NEP, were used as control. Expression of NEP in WT-5 cells after removal of tetracycline from the media resulted in a >80% inhibition in cell proliferation over a 1-week period (P < 0.005) compared with control cells. Tumor formation occurred in the prostate glands of orthotopically injected athymic mice killed at 30 days in 4 of 5 mice that were given injections of 2 x 10(6) WT-5 cells and were fed doxycycline (NEP suppressed), and in all mice that were given injections of TN12 cells and were fed with or without doxycycline. In contrast, only 1 of 5 mouse prostates developed a tumor in mice that were given injections of WT-5 cells and that did not receive doxycycline. Analysis of the mechanisms of NEP-induced growth suppression revealed that NEP expression in WT-5 cells induced a 4-fold increase in the number of PC cells undergoing apoptosis, and increased the expression of p21 tumor suppressor gene protein and the level of unphosphorylated retinoblastoma protein as determined by Western blot. Flow cytometric analysis show that induced NEP expression in WT-5 cells resulted in a G(1) cell cycle arrest. These data show that NEP can inhibit PC cell growth and tumorigenicity and suggest that NEP has potential as therapy for androgen-independent PC.

Androgens↗

Lack of association between the kinetics of human cytomegalovirus (HCMV) glycoprotein B (gB)-specific and neutralizing serum antibodies and development or recovery from HCMV active infection in patients undergoing allogeneic stem cell transplant.

The kinetics of the gB-specific and neutralizing antibody responses to human cytomegalovirus (HCMV) were analyzed in 26 allogeneic stem-cell transplant recipients who either did (n = 20) or did not (n = 6) develop asymptomatic HCMV active infection during the study period. Antibody response profiles varied widely among individuals in both groups, irrespective of whether HCMV active infection did or did not occur. Development of HCMV active infection was not preceded by a decline in functional serum antibody levels. Neither the absence nor the presence of HCMV active infection correlated with either high or low serum levels of gB-specific and neutralizing antibodies, respectively. In most patients, episodes of HCMV replication were not followed by a marked increment in functional serum antibody titers. Therefore, resolution of an ongoing HCMV active infection was not associated with a vigorous antibody response to viral replication. In addition, this study supports previous data indicating that passive transfer of human immunoglobulins may result in an increment in gB-specific and neutralizing serum antibody levels, the magnitude of which varies among recipients; however, both patients with and without measurable increments in serum antibody levels developed HCMV active infections with comparable frequency.

Adult↗

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Androgens↗

Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C delta degradation.

Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.

Amino Acid Sequence↗

Early neutralizing and glycoprotein B (gB)-specific antibody responses to human cytomegalovirus (HCMV) in immunocompetent individuals with distinct clinical presentations of primary HCMV infection.

BACKGROUND: Antibodies with functional anti-Human Cytomegalovirus (HCMV) activity are likely to be involved in preventing virus dissemination and thus may contribute to minimize the clinical manifestations of infection. OBJECTIVES: To investigate the role of humoral immunity in modulating the clinical expression of primary Human Cytomegalovirus (HCMV) infection in immunocompetent persons. STUDY DESIGN: Neutralizing (NA) and glycoprotein B (gB)-specific antibodies were quantitated in acute-phase and late-convalescence phase sera from 19 individuals who developed either HCMV mononucleosis (12) or oligosymptomatic hepatitis (seven). RESULTS: The levels of NA in sera drawn early after infection were significantly lower in the former patients than in the latter (P=0. 032). This difference was not related to either the total serum IgG levels and anti-HCMV IgGs avidity or to the presence of higher viral loads in blood, as assessed by detecting serum HCMV DNA by PCR, in patients experiencing mononucleosis. Increased NA titers were seen in all available late-convalescence sera. In these sera, median NA levels were not significantly different among the study groups. Antibodies to HCMV gB of both IgG and IgM classes were detected in all acute-phase sera analyzed. Median anti-gB IgG and IgM titers did not differ significantly between study groups. Likewise, the IgG subclass reactivity pattern against gB was found to be similar for both groups. CONCLUSIONS: The data revealed that an intense and early antibody response to gB developed in patients undergoing primary HCMV infection irrespective of the clinical manifestation of the disease. In contrast, a deficient NA response was observed in patients with HCMV mononucleosis versus that observed in patients displaying a milder form of disease-suggesting that the strength of NA response to HCMV generated early after infection might determine the severity of primary HCMV infection.

Adolescent↗

Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling.

Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.

Animals↗

Functional antibody response to human cytomegalovirus in immunocompetent and HIV-1 infected individuals with antibodies that inhibit virus penetration into cells and intercellular transmission of viral infection.

Antibodies mediating post-attachment virus neutralisation (PN), inhibition of human cytomegalovirus (HCMV)-induced cell fusion in the glioblastoma cell line U373 (IF) and global neutralising activity (NA) were quantified in sera from healthy immunocompetent individuals, asymptomatic HIV-1-infected subjects and AIDS patients to further characterise the neutralising antibody response to HCMV in these population groups and to assess whether HIV-1-infected individuals exhibited an abnormal functional antibody profile. PN and IF antibodies accounted for a minor fraction of the NA activity of sera from all population groups. Sera from HIV-1-infected individuals (particularly AIDS patients) displayed higher levels of PN and IF antibodies than those from the healthy control group; however, the relative contribution of these antibodies to the global serum NA activity appeared to be lower in the former individuals than in immunocompetent controls. Serum antibodies preventing HCMV cell-to-cell spread (IP) were then measured to determine whether a specific deficiency could be detected in the HIV-1-infected group population. Serum IP antibody titres were significantly higher in HIV-1-infected individuals (particularly in AIDS patients) than in controls. The potential implications of the data for explaining the pathogenesis of HCMV infection are discussed.

Acquired Immunodeficiency Syndrome↗

Enhanced benzaldehyde formation by a monokaryotic strain of Pycnoporus cinnabarinus using a selective solid adsorbent in the culture medium.

A monokaryotic strain of the white-rot fungus Pycnoporus cinnabarinus was shown to produce, in a 2-L bioreactor culture, 100 mg.L-1 benzaldehyde (bitter almond aroma) from L-phenylalanine with a productivity of 33 mg.L-1.day-1. The addition of HP20 resin, a styrene divinylbenzene copolymer highly selective for benzaldehyde, enabled an eightfold increase in the production of benzaldehyde and a twofold increase in productivity. In the presence of HP20 resin, the production of 790 mg.L-1 benzaldehyde was concomitant with the synthesis of cinnamic acid derivatives of high organoleptic notes such as cinnamaldehyde, cinnamyl alcohol, and methyl cinnamate.

Adsorption↗

[Sensitivity of group A beta-hemolytic Streptococcus isolated from pediatric pharyngotonsillitis to erythromycin and clarithromycin: a primary care multicenter study].

BACKGROUND: The recent increase in the prevalence of macrolide-resistant group A beta-haemolytic Streptococcus (BHSGA) strains reported in some areas in Spain and several neighboring countries underscores the need to perform a periodic surveillance, with the adequate methodology, of the level of its susceptibility to these antimicrobials which are frequently used in our country for the treatment of acute streptococcal pharingotonsillitis and respiratory tract infections. PATIENTS AND METHODS: The susceptibility of 293 isolates of BHSGA to the macrolides erythromycin and clarithromycin was evaluated by the broth microdilution procedure recommended by the NCCLS (1997). The isolates were prospectively obtained from children with acute pharyngotonsillitis (n = 757) who were seen at primary care centers in ten Spanish cities. RESULTS: An overall prevalence of 8.9 and 7.8% erythromycin- and clarithromycin-resistant BHSGA isolates was respectively found. The percentage of resistant isolates varied considerably among the different cities subjected to study (0-33%). Overall, the intrinsic activity of clarithromycin (MIC50 and MIC90 of 0.007 and 0.25 mg/ml, respectively) was slightly higher than that of erythromycin (MIC50 and MIC90 of 0.015 and 0.5 mg/ml, respectively). All strains studied were uniformly susceptible to penicillin. CONCLUSIONS: Macrolide antibiotics, erythromycin and clarithromycin, continue to be highly active against BHSGA. The mean level of resistant strains found in Spain from community acquired infections and recovered prospectively is comparable to that of our neighboring countries.

Adolescent↗