Search PubMed⌕ Search

Biomedical subjects

D M Nanus

Publications and source records attributed to D M Nanus.

At least 19 recordsLinked to original sources
PubMed2006

Neuropeptide-stimulated cell migration in prostate cancer cells is mediated by RhoA kinase signaling and inhibited by neutral endopeptidase.

The neuropeptides bombesin and endothelin-1 stimulate prostate cancer (PC) cell migration and invasion (J Clin Invest, 2000; 106: 1399-1407). The intracellular signaling pathways that direct this cell movement are not well delineated. The monomeric GTPase RhoA is required for migration in several cell types including neutrophils, monocytes and fibroblasts. We demonstrate that bombesin-stimulated PC cell migration occurs via the heterotrimeric G-protein-coupled receptors (G-protein) G alpha 13 subunit leading to activation of RhoA, and Rho-associated coiled-coil forming protein kinase (ROCK). Using siRNA to suppress expression of the three known G-protein alpha-subunit-associated RhoA guanine nucleotide exchange factors (GEFs), we also show that two of these RhoA GEFs, PDZ-RhoGEF and leukemia-associated RhoGEF (LARG), link bombesin receptors to RhoA in a non-redundant manner in PC cells. We next show that focal adhesion kinase, which activates PDZ-RhoGEF and LARG, is required for bombesin-stimulated RhoA activation. Neutral endopeptidase (NEP) is expressed on normal prostate epithelium whereas loss of NEP expression contributes to PC progression. We also demonstrate that NEP inhibits neuropeptide activation of RhoA. Together, these results establish a contiguous signaling pathway from the bombesin receptor to ROCK in PC cells, and they implicate NEP as a major regulator of neuropeptide-stimulated RhoA in these cells. This work also identifies members of this signaling pathway as potential targets for rational pharmacologic manipulation of neuropeptide-stimulated migration of PC cells.

Bombesin↗
PubMed2006

Activation of p300 histone acetyltransferase activity and acetylation of the androgen receptor by bombesin in prostate cancer cells.

Androgen receptor signaling in prostate cancer cells is augmented by the androgen receptor (AR) coactivator p300, which transactivates and acetylates the AR in the presence of dihydrotestosterone (DHT). As prostate cancer (PC) cells progress to androgen independence, AR signaling remains intact, indicating that other factors stimulate AR activities in the absence of androgen. We previously reported that neuropeptide growth factors could transactivate the AR in the presence of very low concentrations of DHT. Here, we examine the involvement of p300 in neuropeptide activation of AR signaling. Transfection of increasing concentrations of p300 in the presence of bombesin into PC-3 cells resulted in a linear increase in AR transactivation, suggesting that p300 acts as a coactivator in neuropeptide-mediated AR transactivation. P300 is endowed with histone acetyltransferase (HAT) activity. Therefore, we examine the effect of bombesin on p300 HAT activity. At 4 h after the addition of bombesin, p300 HAT activity increased 2.0-fold (P<0.01). Incubation with neutral endopeptidase, which degrades bombesin, or bombesin receptor antagonists blocked bombesin-induced p300 HAT activity. To explore the potential signaling pathways involved in bombesin-induced p300 HAT activity, we examined Src and PKCdelta pathways that mediate bombesin signaling. Inhibitors of Src kinase activity or Src kinase siRNA blocked bombesin-induced p300 HAT activity, whereas PKCdelta inhibitors or PKCdelta siRNA significantly increased bombesin-induced p300 HAT activity suggesting that Src kinase and PKCdelta kinase are involved in the regulation of p300 HAT activity. As AR is acetylated in the presence of 100 nM DHT, we next examined whether bombesin-induced p300 HAT activity would result in enhanced AR acetylation. Bombesin-induced AR acetylation at the same motif KLKK observed in DHT-induced acetylation. Elimination of p300 using p300 siRNA reduced AR acetylation, demonstrating that AR acetylation was mediated by p300. AR acetylation results in AR transactivation and the expression of the AR-regulated gene prostate-specific antigen (PSA). Therefore, we examined bombesin-induced AR transactivation and PSA expression in the presence and absence of p300 siRNA and found inhibition of p300 expression reduced bombesin-induced AR transactivation and PSA expression. Together these results demonstrate that bombesin, via Src and PKCdelta signaling pathways, activates p300 HAT activity which leads to enhanced acetylation of AR resulting in increased expression of AR-regulated genes.

Acetylation↗
PubMed2004

Downregulation of Bcl-2 sensitises interferon-resistant renal cancer cells to Fas.

Interferon alpha (IFNalpha) is used to treat patients with advanced renal cell carcinoma (RCC) despite limited clinical benefit. IFNalpha can induce Fas receptor-mediated apoptosis by direct activation of pro-caspase-8 followed by activation of caspase-3. Alternative, indirect activation of caspase-3 via mitochondrial release of cytochrome c can occur and may explain the rescue from Fas-activated cell death by the antiapoptotic members of the Bcl-2 family. In this study, we examined G3139, a novel antisense compound targeting Bcl-2, in combination with IFNalpha. Human RCC lines (SK-RC-44 and SK-RC-07) were treated with IFNalpha, G3139 or a combination of the two. Fas-mediated cytotoxicity was induced by anti-Fas mAb, CH11. An analysis of Bcl-2, Fas and the cleavage of PARP was performed. IFNalpha induced Fas and Bcl-2 in SK-RC-44 and SK-RC-07. IFNalpha sensitised SK-RC-44 to anti-Fas and induced PARP cleavage confirming that IFNalpha has a cytotoxic effect on RCC lines by induction of the Fas antigen. Cytotoxicity was not evident in SK-RC-07 cells treated with IFNalpha. G3139 induced a specific downregulation of Bcl-2 in SK-RC-07 cells, which were then sensitised to anti-Fas after treatment with IFNalpha. Taken together, these results suggest that Fas-dependent pathways as well as alternative pathways, which can be inhibited by Bcl-2, exist in renal cell carcinoma. G3139 in combination with IFNalpha is a potential therapy in patients with metastatic renal cell carcinoma.

Antineoplastic Agents↗
PubMed2001

Neutral endopeptidase inhibits neuropeptide-mediated transactivation of the insulin-like growth factor receptor-Akt cell survival pathway.

G-protein coupled receptor (GPCR) agonists such as neuropeptides activate the insulin-like growth factor-1 receptor (IGF-IR) or the serine-threonine protein kinase Akt, suggesting that neuropeptides-GPCR signaling can cross-communicate with IGF-IR-Akt signaling pathways. Neutral endopeptidase 24.11 (NEP) is a cell-surface peptidase that cleaves and inactivates the neuropeptides endothelin-1 (ET-1) and bombesin, which are implicated in progression to androgen-independent prostate cancer (PC). We investigated the mechanisms of NEP regulation of neuropeptide-mediated cell survival in PC cells, including whether neuropeptide substrates of NEP induce phosphorylations of IGF-IR and Akt in PC cells. Western analyses revealed ET-1 and bombesin treatment induced phosphorylation of IGF-IRbeta and Akt independent of IGF-I in TSU-Pr1, DU145, and PC-3 PC cells, which lack NEP expression, but not in NEP-expressing LNCaP cells. Recombinant NEP and induced NEP expression in TSU-Pr1 cells using a tetracycline-repressive expression system inhibited ET-1-mediated phosphorylation of IGF-IRbeta and Akt, and blocked the protective effects of ET-1 against apoptosis induced by serum starvation. Incubation of TSU-Pr1 cells with specific kinase inhibitors together with ET-1 or bombesin showed that IGF-IR activation is required for neuropeptide-induced Akt phosphorylation, and that neuropeptide-induced Akt activation is predominantly mediated by Src and phosphatidylinositol 3-kinase but not by mitogen-activated protein kinase or protein kinase C. These data show that the neuropeptides ET-1 and bombesin stimulate ligand-independent activation of the IGF-IR, which results in Akt activation, and that this cross-communication between GPCR and IGF-IR signaling is inhibited by NEP.

Bombesin↗
PubMed2001

Reduced levels of retinyl esters and vitamin A in human renal cancers.

Clinical and preclinical studies suggest that retinoids can inhibit the growth of a small percentage of human renal cancers (RCs), although the majority of RCs both in vitro and in vivo are retinoid resistant. Our recent studies indicate that the metabolism of retinol to retinyl esters is greatly reduced in human carcinoma cell lines of the oral cavity, skin, and breast as compared with their normal epithelial counterparts, suggesting that human carcinoma cells are retinoid deficient relative to normal epithelial cells. We considered whether retinoid resistance in RCs was related to an abnormality in retinoid metabolism. The metabolism of [3H]retinol and of [3H]retinoic acid (RA) was examined in RC cell lines and normal human kidney (NK) epithelial cells cultured in media, in RA, or in RA plus IFN-alpha. The expression of LRAT (lecithin:retinol acyltransferase) was assessed by Northern and Western analysis. Retinol and retinyl ester levels were determined in tissue samples of normal human kidney and renal cell carcinoma. NK cells esterified all of the 50 nM [3H]retinol in which they were cultured. In contrast, six of the seven RC cell lines metabolized only trace amounts of [3H]retinol to [3H]retinyl esters. Consistent with this relative lack of [3H]retinol esterification by the tumor cells, the tumor cells exhibited LRAT transcripts of aberrantly low sizes relative to those in normal epithelial cells. Moreover, the NK cells expressed abundant levels of LRAT protein by Western analysis, whereas the RC cells did not express LRAT protein. When samples of human kidney tumor tissue were compared with samples of normal kidney tissue from patients who had undergone surgery for primary RC, the normal kidney tissues contained much higher levels of retinol and retinyl esters (approximately 0.5-2 microg/gram wet weight) than the tumor tissues in all seven patients examined. Culture of the RC lines in IFN-alpha plus all-trans-RA, a combination therapy used clinically, resulted in higher intracellular levels of [3H]retinol and [3H]retinyl esters. The metabolism of [3H]RA was also examined in these RC lines versus NK cells. Although the NK epithelial cells metabolized [3H]RA, the majority of the RC lines metabolized [3H]RA at a much slower rate. Most of the RC lines metabolized only 10-30% of the 50 nM [3H]RA over 6 h of culture. These data indicate that RCs both in vitro and in vivo are retinol and retinyl ester deficient relative to the normal human kidney, and they suggest that the aberrant differentiation of the neoplastic renal cells results in part from a defect in retinoid metabolism.

Acyltransferases↗
PubMed2001

Advanced renal cell carcinoma.

Advanced renal cell carcinoma (RCC) is a disease that is highly resistant to systemic therapy and is difficult to treat. Nephrectomy should be seriously considered in patients who present with metastatic disease prior to systemic therapy, and surgery remains a reasonable option in patients who present with resectable metastases. Numerous studies with many different treatment modalities, including chemotherapy, immunotherapy, and radiation therapy, have failed to consistently benefit patients, with no single agent or combination therapy showing a reproducible response proportion of 20% or higher. Interleukin-2 (IL-2) and interferon-alfa (IFN alfa)-based therapies remain the most commonly used agents to treat patients with advanced disease, demonstrating low but reproducible response proportions in the 10% to 20% range, with durable responses of 5% or less. Recent randomized studies demonstrate a survival advantage for patients receiving systemic IFN-based therapy, but this advantage is marginal. Novel treatment strategies are being investigated, with some encouraging early results using vaccines and allogeneic bone marrow transplant. The identification of new agents with more effective antitumor activity is a high priority in the treatment of advanced RCC.

Aged↗
PubMed2001

Tumor-suppressive effects of neutral endopeptidase in androgen-independent prostate cancer cells.

Expression of neutral endopeptidase (NEP) 24.11 is diminished in metastatic, androgen-independent prostate cancers (PCs; C. N. Papandreou et al., NAT: MED:, 4: 50--57, 1998). To determine the effects on androgen-independent PC cells of overexpressing cell-surface NEP, an inducible tetracycline-regulatory gene expression system was used to stably introduce and express the NEP gene in androgen-independent TSU-Pr1 cells generating WT-5 cells, which expressed high levels of enzymatically active NEP protein when cultured in the absence of tetracycline. TN12 cells, which contain the identical vectors without the NEP gene and do not express NEP, were used as control. Expression of NEP in WT-5 cells after removal of tetracycline from the media resulted in a >80% inhibition in cell proliferation over a 1-week period (P < 0.005) compared with control cells. Tumor formation occurred in the prostate glands of orthotopically injected athymic mice killed at 30 days in 4 of 5 mice that were given injections of 2 x 10(6) WT-5 cells and were fed doxycycline (NEP suppressed), and in all mice that were given injections of TN12 cells and were fed with or without doxycycline. In contrast, only 1 of 5 mouse prostates developed a tumor in mice that were given injections of WT-5 cells and that did not receive doxycycline. Analysis of the mechanisms of NEP-induced growth suppression revealed that NEP expression in WT-5 cells induced a 4-fold increase in the number of PC cells undergoing apoptosis, and increased the expression of p21 tumor suppressor gene protein and the level of unphosphorylated retinoblastoma protein as determined by Western blot. Flow cytometric analysis show that induced NEP expression in WT-5 cells resulted in a G(1) cell cycle arrest. These data show that NEP can inhibit PC cell growth and tumorigenicity and suggest that NEP has potential as therapy for androgen-independent PC.

Androgens↗
PubMed2000

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Androgens↗
PubMed2000

Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C delta degradation.

Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.

Amino Acid Sequence↗
PubMed2000

New treatment approaches for metastatic renal cell carcinoma.

Metastatic renal cell carcinoma remains a disease that is highly resistant to systemic therapy and difficult to treat. Numerous studies with many different treatment modalities have resulted in only minor advances. No single agent or combination therapy has consistently shown a response proportion of 20% or higher. Interleukin-2 and interferon-alpha-based therapies are most commonly used to treat advanced disease, demonstrating low but reproducible response proportions in the 10% to 20% range, with durable responses of 5% or less. In the last few years, randomized studies have for the first time demonstrated a survival advantage for patients receiving systemic therapy, although this advantage is marginal. A number of novel treatment strategies are being investigated with some encouraging early results. The identification of new agents with better antitumor activity remains a high priority in the treatment of advanced renal cell carcinoma.

Antibodies, Monoclonal↗
PubMed2000

Analysis of the insertion/deletion polymorphism of the human angiotensin converting enzyme (ACE) gene in patients with renal cancer.

The angiotensin I-converting enzyme (ACE) contains an insertion/deletion (I/D) polymorphism, with the DD genotype associated with benign renal diseases. The distribution frequencies of the D and I alleles, and the DD, DI and II genotypes were determined in DNA extracted from kidney tissues of 58 renal cancer patients. The observed frequencies in patients who develop renal cancer was not significantly different than the normal population.

Adult↗
PubMed2000

Interaction of retinoic acid and interferon in renal cancer cell lines.

Retinoic acid (RA) can potentiate the antitumor effect of interferons (IFN) in a variety of tumor types, including renal cell carcinoma (RCC). The mechanisms by which RA and IFN increase the antitumor effects in RCC are unknown. We used growth assays and mobility shift assays to examine the effects of combining 13-cis-retinoic acid (CRA) and IFN-alpha (plus IFN-gamma) on proliferation and on the expression of the IFN-specific transcription factor IFN-stimulated gene factor 3 (ISGF3) in RCC cell lines. Combining CRA and IFN-alpha resulted in a significant increase in growth inhibition in four cell lines compared with IFN-alpha or CRA alone. Binding of nuclear extracts from RCC cells to an IFN-stimulated response element (ISRE) oligonucleotide probe following incubation with IFN-alpha was not increased by CRA but was significantly increased by pretreatment by IFN-gamma in a time-dependent fashion. Proliferation assays showed that sequential addition of IFN-gamma and IFN-alpha significantly increased growth inhibition. IFN-alpha but not IFN-gamma or CRA increased the cellular levels Stat2 and p48 but not Statl. IFN-gamma pretreatment enhanced the upregulation of p48 levels by IFN-alpha. Combining RA and IFN results in additive growth inhibition on RCC cell lines. This increase in growth inhibition is not mediated by increased ISGF3 expression.

Antineoplastic Agents↗
PubMed2000

Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling.

Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.

Animals↗
PubMed2000

Phase III trial of interferon alfa-2a with or without 13-cis-retinoic acid for patients with advanced renal cell carcinoma.

PURPOSE: A randomized phase III trial was conducted to determine whether combination therapy with 13-cis-retinoic acid (13-CRA) plus interferon alfa-2a (IFNalpha2a) is superior to IFNalpha2a alone in patients with advanced renal cell carcinoma (RCC). PATIENTS AND METHODS: Two hundred eighty-four patients were randomized to treatment with IFNalpha2a plus 13-CRA or treatment with IFNalpha2a alone. IFNalpha2a was given daily subcutaneously, starting at a dose of 3 million units (MU). The dose was escalated every 7 days from 3 to 9 MU (by increments of 3 MU), unless >/= grade 2 toxicity occurred, in which case dose escalation was stopped. Patients randomized to combination therapy were given oral 13-CRA 1 mg/kg/d plus IFNalpha2a. Quality of life (QOL) was assessed. RESULTS: Complete or partial responses were achieved by 12% of patients treated with IFNalpha2a plus 13-CRA and 6% of patients treated with IFNalpha2a (P =.14). Median duration of response (complete and partial combined) in the group treated with the combination was 33 months (range, 9 to 50 months), versus 22 months (range, 5 to 38 months) for the second group (P =.03). Nineteen percent of patients treated with IFNalpha2a plus 13-CRA were progression-free at 24 months, compared with 10% of patients treated with IFNalpha2a alone (P =.05). Median survival time for all patients was 15 months, with no difference in survival between the two treatment arms (P =.26). QOL decreased during the first 8 weeks of treatment, and a partial recovery followed. Lower scores were associated with the combination therapy. CONCLUSION: Response proportion and survival did not improve significantly with the addition of 13-CRA to IFNalpha2a therapy in patients with advanced RCC. 13-CRA may lengthen response to IFNalpha2a therapy in patients with IFNalpha2a-sensitive tumors. Treatment, particularly the combination therapy, was associated with a decrease in QOL.

Administration, Oral↗
PubMed2000

Androgen-induced growth inhibition of androgen receptor expressing androgen-independent prostate cancer cells is mediated by increased levels of neutral endopeptidase.

Androgen-mediated growth repression of androgen-independent prostate cancer (AIPC) cells has been reported in androgen-independent PC-3 cells overexpressing the androgen receptor, and in androgen-independent derivatives of LNCaP cells that develop following prolonged culture in androgen-free media. Using two models of AIPC, PC3/AR cells and LNCaP-OM1 cells, a subclone of LNCaP cells derived by prolonged culturing in charcoal-stripped media, we investigated whether expression of neutral endopeptidase 24.11 (NEP), a cell-surface peptidase that cleaves and inactivates neuropeptides implicated in the growth of AIPC, is induced by androgen, and whether NEP contributes to the observed androgen-mediated growth repression. These cell lines each express high levels of androgen receptor. Culturing in dihyrotestosterone (DHT) resulted in a 30-56% (PC3) and 35-43% (LNCaP-OM1) decrease in cell number over 7 days concomitant with a significant increase in NEP enzyme specific activity. Northern analysis detected an increase in NEP transcripts following DHT treatment in PC3/AR cells. The addition of the NEP enzyme inhibitor phosphoramidon to PC3 and LNCaP-OM1 or the NEP competitive inhibitor CGS 24592 to LNCaP-OM1 blocked the increase in NEP enzyme activity and reversed the DHT-induced growth inhibition. Neither phosphoramidon or CGS 24592 alone inhibited cell growth. Furthermore, the reversal of growth inhibition in LNCaPOM1 cells was dose dependent on the concentration of CGS 24592. These data indicate that androgen-induced growth repression of AIPC cells PC3 and LNCaP-OM1 results in part from androgen-induced expression of NEP in these cells.

Androgens↗
PubMed2000

The development of biologic end points in patients treated with differentiation agents: an experience of retinoids in prostate cancer.

The evaluation of new therapies in prostate cancer requires unique end points for agents with diverse mechanisms of action. Because retinoic acid may have a confounding effect on prostate-specific antigen, we incorporated a pathological end point into the outcome assessment of two sequential clinical trials using all-trans-retinoic acid (ATRA) and the combination of 13-cis-retinoic acid and IFN-2a (cRA¿IFN). Pre- and posttherapy tumor biopsy specimens were studied for histological changes, apoptosis (terminal deoxynucleotidyl transferase-mediated nick end labeling assay), and proliferation index (Ki67). Prostate-specific membrane antigen (PSMA) expression was also evaluated using two different monoclonal antibodies to its intracellular domain (Cytogen 7E11 and Hybritech PM2). Fourteen patients with androgen-independent disease were treated with ATRA (50 mg/m2 p.o. every 8 h daily) and 16 androgen-independent and 4 androgen-dependent patients were treated with cRA¿IFN (10 mg/kg/day cRA plus 3, 6, or 9 million units daily IFN). Both therapies were well tolerated, with fatigue and cheilitis being the most common adverse events. Clinical activity, assessed by radiographs and serum prostate-specific antigen, was minimal, and the majority of patients progressed within 3 months. One patient with androgen-dependent disease had prolonged stabilization for >1 year. The majority of cases (95%) showed no gross histological changes and no difference in apoptotic or proliferative indices. Increased PSMA immunoreactivity was seen in seven of nine (78%) cases using PM2 antibody and in two of nine (22%) cases using the 7E11 antibody. Although antitumor effects were modest, the results suggest a role for retinoids in modulating the expression of PSMA on prostate cancer cells.

Aged↗
PubMed2000

Novel investigative approaches for advanced renal cell carcinoma.

Metastatic renal cell carcinoma remains one of the most treatment-resistant malignancies in humans. As such, long-term survival is limited to a minority of patients. Interferon-alpha and interleukin-2 induced major responses in some patients with renal cell carcinoma, and in so doing generated a great deal of interest and hope. However, clinical benefit is limited to relatively few patients. Here, we briefly discuss the management of metastatic renal cell carcinoma, and then elaborate on several novel treatment approaches in development, including retinoids, monoclonal antibodies, and antiangiogenesis strategies.

Adjuvants, Immunologic↗