Search PubMed⌕ Search

Biomedical subjects

D M Chikaraishi

Publications and source records attributed to D M Chikaraishi.

At least 19 recordsLinked to original sources

A tyrosine hydroxylase-yellow fluorescent protein knock-in reporter system labeling dopaminergic neurons reveals potential regulatory role for the first intron of the rodent tyrosine hydroxylase gene.

Degeneration of the dopaminergic neurons of the substantia nigra is a hallmark of Parkinson's disease. To facilitate the study of the differentiation and maintenance of this population of dopaminergic neurons both in vivo and in vitro, we generated a knock-in reporter line in which the yellow fluorescent protein (YFP) replaced the first exon and the first intron of the tyrosine hydroxylase (TH) gene in one allele by homologous recombination. Expression of YFP under the direct control of the entire endogenous 5' upstream region of the TH gene was predicted to closely match expression of TH from the wild type allele, thus marking functional dopaminergic neurons. We found that YFP was expressed in dopaminergic neurons differentiated in vitro from the knock-in mouse embryonic stem cell line and in dopaminergic brain regions in knock-in mice. Surprisingly, however, YFP expression did not overlap completely with TH expression, and the degree of overlap varied in different TH-expressing brain regions. Thus, the reporter gene did not identify functional TH-expressing cells with complete accuracy. A DNaseI hypersensitivity assay revealed a cluster of hypersensitivity sites in the first intron of the TH gene, which was deleted by insertion of the reporter gene, suggesting that this region may contain cis-acting regulatory sequences. Our results suggest that the first intron of the rodent TH gene may be important for accurate expression of TH.

Animals↗

4.5 kb of the rat tyrosine hydroxylase 5' flanking sequence directs tissue specific expression during development and contains consensus sites for multiple transcription factors.

To delineate DNA sequences responsible for developmentally correct expression of the rat tyrosine hydroxylase (TH) gene, we analyzed a line of transgenic mice expressing high levels of human placental alkaline phosphatase (AP) under control of 4.5 kb of 5' flanking DNA from the rat TH gene in embryos and adults. Several regions, such as the accessory olfactory bulb, which were not thought to synthesize TH protein or do so only transiently, were shown to express TH protein using an improved method of antigen retrieval for TH immunohistochemistry. Many of these regions had been shown to express TH-driven reporter genes in transgenic mice. In the central nervous system, AP was detected in essentially all TH-expressing cell groups throughout development and in adults. In the peripheral nervous system, transgene expression paralleled endogenous TH expression in the developing adrenal medulla and sympathetic ganglia but not in transiently TH-positive cells in dorsal root ganglia. Peripheral expression in the adult adrenal medulla was very weak and absent in sympathetic ganglia. The specificity with which the 4.5 kb region directs transgene expression in embryos is comparable to that observed with longer 5' flanking promoter regions, implying that this region contains the control elements for appropriate expression during development. Sequence analysis of the region demonstrates a GT dinucleotide repeat, an element that resembles the neural restrictive silencer element (NRSE), which restricts transcription of neuronal genes in non-neuronal cells, and consensus sites for three families of transcription factors, Ptx1/3, Nurr1 and Gli1/2, which are required for the early differentiation of mesencephalic neurons.

Alkaline Phosphatase↗

Differentiation of a catecholaminergic CNS cell line modifies tyrosine hydroxylase transcriptional regulation.

Recently, a tyrosine hydroxylase (TH)-expressing CNS-derived cell line, CAD, was obtained that is capable of undergoing reversible morphological differentiation. The isolation of the CAD line allowed us to ask whether different DNA regulatory elements direct TH transcription when cells are growing and undifferentiated versus postmitotic and differentiated. To this end, we compared expression of a transiently transfected bacterial chloramphenicol acetyltransferase reporter gene under the transcriptional control of TH 5' flanking DNA in CAD cells grown in the presence and absence of serum. Mutational analysis indicates that CAD cells differently regulate TH transcription depending on their state of differentiation. In both states, the cyclic AMP response element and AP1 site each activate transcription. However, in undifferentiated cells, the dyad/E-box element represses expression by approximately 2.7-fold, whereas it modestly activates transcription in differentiated cells. The role of the dyad/ E-box as a repressor correlates well with the two- to threefold lower amount of endogenous TH protein present in the undifferentiated CAD cells. This study demonstrates the differential use of TH DNA regulatory elements in proliferating, undifferentiated and nonproliferating, differentiated immortalized neuronal cells.

Animals↗

A novel basal promoter element is required for expression of the rat tyrosine hydroxylase gene.

Transcription of the rat tyrosine hydroxylase (TH) gene is controlled by enhancer sequences in its 5' flanking region; these enhancers include the AP1, dyad, and cAMP response element (CRE) motifs. We show that a novel basal promoter element (-17 GCCTGCCTGGCGA -5) positioned between the TATA box and +1 works in conjunction with the upstream AP1-dyad and CRE enhancers but cannot support transcription by itself. A mutation of this element, termed partial dyad, reduces basal expression of a reporter gene in TH-positive cell lines and TH-negative lines but has no effect on cAMP- or KCl-induced expression. A double mutant at positions -17 and -11 of the partial dyad reduces transcriptional activation by 80%. Conversely, insertion of this element into a heterologous promoter restores basal expression to levels mediated by the native TH promoter. The partial dyad is a novel activational element that is required for full expression of the TH gene and may assist in the function of the AP1, dyad, and CRE motifs and also other enhancers further upstream. Hence, the rat TH gene is unusual in that its enhancers will not function with a heterologous promoter but require a specific TH promoter sequence for full activation.

Animals↗

Characterization of a CNS cell line, CAD, in which morphological differentiation is initiated by serum deprivation.

A CNS catecholaminergic cell line, Cath.a, was established by targeted oncogenesis in transgenic mice. Cath.a cells express neuronal properties but lack neuronal morphology. Here, we describe a variant of Cath.a, called CAD (Cath.a-differentiated), in which reversible morphological differentiation can be initiated by removal of serum or exogenously added protein from the medium. In serum- or protein-free media, CAD cells stop proliferating and extend long processes. Differentiated CAD cells can be maintained without serum or protein for at least 6 weeks. CAD cells are distinct from Cath.a cells; most significant, the original immortalizing oncogene, SV40 T antigen, was spontaneously lost. By immunostaining or immunoblotting, we show that CAD cells express neuron-specific proteins, such as class III beta-tubulin, GAP-43, SNAP-25, and synaptotagmin, but not GFAP. Ultrastructurally, processes from differentiated CAD cells have abundant parallel microtubules and intermediate filaments, and bear varicosities that contain both large dense-core vesicles/granules (120-160 nm) and smaller clear vesicles (60-80 nm). Additionally, CAD cells express enzymatically active tyrosine hydroxylase and accumulate L-DOPA. CAD cells exhibit biochemical and morphological characteristics of primary neurons and provide an unique tool for studying neuronal differentiation.

Animals↗

Induction of tyrosine hydroxylase protein and a transgene containing tyrosine hydroxylase 5' flanking sequences by stress in mouse adrenal gland.

Prolonged stress is associated with the induction of tyrosine hydroxylase (TH) gene expression in rat adrenal medulla. We have used transgenic mice expressing a transgene encoding 4.5 kb of rat TH gene 5' flanking region fused upstream of the structural gene encoding chloramphenicol acetyltransferase (CAT) to test whether cold exposure or immobilization stress regulates TH gene expression in mouse adrenal gland. Exposure of mice to cold for 3 days increases adrenal TH protein and enzymatic activity. Cold exposure also increases adrenal TH-CAT expression two- to threefold. Immobilization stress induces mouse adrenal TH-CAT expression after either one immobilization or multiple immobilizations. TH-CAT expression increases transiently after a single immobilization, but after multiple immobilizations the induction of TH-CAT is sustained for at least 24 h. TH protein and TH enzymatic activity in mouse adrenal gland are elevated 2.8-fold and 1.5-fold, respectively, after seven immobilizations, but are not increased after either one, two, or three immobilizations. These results indicate that cold exposure and immobilization stress induce adrenal TH gene expression at least partially by stimulating the transcription rate of the TH gene. Furthermore, as observed in the rat, multiple mechanisms apparently regulate adrenal TH gene transcription rate and TH enzyme induction depending on whether mice are subjected to a single immobilization or multiple immobilizations. Our results indicate that these transgenic mice are an excellent model system to study the molecular mechanisms regulating TH gene expression in adrenal medulla.

Adrenal Glands↗

A CNS catecholaminergic cell line expresses voltage-gated currents.

CATH.a is a central nervous system (CNS) catecholaminergic cell line derived from a transgenic mouse carrying the SV40 T antigen oncogene under the transcriptional control of regulatory elements from the rat tyrosine hydroxylase gene (Suri et al., 1993). CATH.a cells express several differentiated neuronal characteristics including medium and light chain neurofilament proteins, synaptophysin, tyrosine hydroxylase, and dopamine beta-hydroxylase; they synthesize dopamine and norepinephrine. Conversely, they do not express glial-specific fibrillary acidic protein. To establish definitively that CATH.a cells are of neuronal origin, we characterized the repertoire of voltage-gated inward currents expressed by CATH.a cells. Such inward currents are necessary for neuronal excitability. We report that all CATH.a cells possess a tetrodotoxin-sensitive sodium current (peak amplitude = 590 +/- 319 pA) and 68% possess a high voltage-activated calcium current (peak amplitude = 175 +/- 67 pA). Pharmacological analyses suggest that individual cells express varying levels of L- and N-type calcium current, but no P-type current. In addition, in 55% of the cells with a calcium current, about a half of this current is resistant to selective antagonists for L- and N-type currents, suggesting that another calcium current exists in these CATH.a cells which is not L-, N-, or P-type. The heterogeneous pattern of current detected persisted in several CATH. a subclones, suggesting that factors other than genetic variability influence current expression. The demonstration that CATH.a cells express these currents indicates that they have excitable membrane properties characteristic of neurons. Although many peripheral nervous system (PNS) cell lines exist, very few CNS cell lines with differentiated neuronal properties exist. Since the CATH.a cells can be grown continuously in large amounts, they may be useful for purifying, characterizing, and/or cloning various neuronal-specific molecules and thereby may add to our understanding of CNS catecholaminergic neurons.

Animals↗

The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice.

Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at -45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the AP1/dyad (AD) element at -205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at -91 or -95. However, in its native context at -205, the AD could not support expression. In contrast, a CRE, moved from its normal position at -45 to -206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context-and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines.

Adrenal Gland Neoplasms↗

Autofeedback suppression of growth hormone (GH) secretion in transgenic mice expressing a human GH reporter targeted by tyrosine hydroxylase 5'-flanking sequences to the hypothalamus.

Transgenic mice expressing a tyrosine hydroxylase-human (h) GH fusion gene in the hypothalamus exhibit a dwarf phenotype. The GH feedback mechanism(s) underlying the growth retardation in these animals was investigated by assessing peptide and messenger RNA (mRNA) levels of the hormones of the hypothalamic-GH-IGF-I axis. Pituitary GH content, hypothalamic GH-releasing hormone (GHRH) and somatostatin (SRIH) content, and serum IGF-I levels were measured by RIA. mRNA levels of hypothalamic GHRH and SRIH and of pituitary GH and the GHRH receptor were measured by Northern blot hybridization. Transgenic mice of both sexes and their wild-type littermates were studied at 2-4 months of age. The pituitary GH content was markedly reduced by 85% in male and by 87% in female transgenic mice compared to that in wild-type controls (P < 0.01 for both). The pituitary GH mRNA content was also decreased by 73% (P = 0.002) in transgenic male mice. Circulating IGF-I levels were significantly reduced by 66% and 68% in male and female transgenic mice, respectively (P = 0.001). The hypothalamic GHRH content was significantly reduced by 19% and 33% (P < 0.05) in male and female transgenic mice, respectively. No significant difference was detected, however, in the hypothalamic SRIH content between wild-type and transgenic mice. Hypothalamic GHRH mRNA levels were significantly decreased by 35% (P = 0.002) in transgenic male mice compared to those in wild-type littermates. In contrast, SRIH mRNA was not significantly changed. An even greater reduction (61%; P = 0.003) was observed in pituitary GHRH receptor mRNA in transgenic mice. These data indicate that the GH deficiency and dwarf phenotype of the tyrosine hydroxylase-hGH transgenic mouse can be attributed primarily to impaired hypothalamic GHRH production. The mechanism of GH feedback inhibition appears to involve direct suppression of GHRH gene expression by locally produced hGH in the hypothalamus.

Animals↗

Olfactory marker protein mRNA is found in axons of olfactory receptor neurons.

The separation between the cell bodies of olfactory receptor neurons in the nasal cavity and their axon terminals in the olfactory bulb make them attractive for studying axonal transport. Although high molecular weight RNAs are generally believed to be excluded from axons of mature neurons, we demonstrate here that mRNA for olfactory marker protein (OMP), an abundant cytoplasmic protein selectively expressed in mature receptor cells, is present in rodent olfactory receptor axons. OMP RNA was detected by in situ hybridization at the light microscope level in axons and in terminals. By nuclease protection, the level of OMP RNA in the olfactory bulb was 5-10% of that in the olfactory epithelium where the cell bodies reside. In contrast to axonally transported vasopressin and oxytocin mRNAs, which are deficient in their 3' polyA tails, axonal OMP RNA fractionated as polyA+. OMP RNA was lost from axons and terminals after deafferentation, suggesting that OMP RNA was synthesized in receptor cell bodies in the epithelium and was transported into axons and terminals in the olfactory bulb. RNA for G(olf), a G-protein highly expressed in dendrites of mature olfactory receptor neurons, was not detected in the olfactory bulb. We hypothesize that the immature nature of the cytoskeleton and, specifically, the lack of tightly bundled microtubules allows transport of particular mRNAs in olfactory receptor axons.

Afferent Pathways↗

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.

Adrenal Gland Neoplasms↗

The Oct-2 transcription factor represses tyrosine hydroxylase expression via a heptamer TAATGARAT-like motif in the gene promoter.

The tyrosine hydroxylase (TH) gene promoter contains adjacent octamer and heptamer motifs which act as target sites for octamer binding transcription factors. Mutation of the heptamer motif but not the octamer motif enhances TH promoter activity in neuronal cells expressing Oct-2 but not in non-expressing fibroblasts. Similarly addition of the heptamer motif to a minimal TH promoter represses gene expression in neuronal cells but not in fibroblasts. These effects can be reproduced by the artificial expression of neuronal isoforms of Oct-2 in fibroblasts which results in the repression of transfected TH promoters containing an intact heptamer motif but not those in which this motif has been mutated or deleted. The TH promoter thus represents the first example of a cellular promoter which is repressed by Oct-2. The significance of this effect is discussed in terms of the cell type specificity of the TH promoter and its induction by different physiological stimuli.

Alternative Splicing↗

DNA regulatory sequences of the rat tyrosine hydroxylase gene direct correct catecholaminergic cell-type specificity of a human growth hormone reporter in the CNS of transgenic mice causing a dwarf phenotype.

Transgenic mice bearing 4.8 kilobases (kb) of upstream rat tyrosine hydroxylase (TH) sequences linked to a human growth hormone gene (hGH) exhibited cell-specific expression of hGH in all the appropriate catecholaminergic neurons in the central nervous system (CNS), although with different penetrance in two different mouse lineages. No ectopic expression was observed in any brain or peripheral region in one founder and its progeny. In another founder there was some ectopic expression in addition to appropriate and high levels of tissue-specific expression in all catecholaminergic areas. These results identify regulatory sequences that are sufficient for targeting expression to all catecholaminergic CNS neurons. Also, expression of exogenous hGH in the hypothalamus caused a dwarf phenotype, generating a novel genetic model for GH deficiency of hypothalamic origin.

Aging↗

Molecular phenotype of simian virus 40 large T antigen-induced primitive neuroectodermal tumors in four different lines of transgenic mice.

BACKGROUND: We compared the molecular phenotypes of central nervous system tumors arising in four different lines of transgenic mice (TGM) carrying the Simian virus 40 large T antigen driven by different promoters or enhancers. Two of the four lines developed primitive neuroectodermal tumors (PNETs) in the brain stem or pineal gland. A third TGM line developed retinoblastomas (a PNET-like tumor of the retina) as well as PNETs in the mesencephalon, while the fourth TGM developed retinoblastomas and adrenal pheochromocytomas. EXPERIMENTAL DESIGN: The expression of developmentally regulated polypeptides specific for the neuronal or glial lineage was examined in these PNETs using immunohistochemistry and Western blotting. RESULTS: Neoplastic cells in all of the PNETs exhibited neuronal, but no glial specific markers as evidenced by the invariable expression of synaptophysin, but no detectable glial fibrillary acidic protein or myelin basic protein. PNETs with a more differentiated neuronal phenotype expressed multiple neuronal polypeptides. The phenotypic properties of these PNETs closely resembled those found in human brain PNET biopsy samples and cell lines derived therefrom. CONCLUSIONS: We conclude that Simian virus 40 T antigen-induced PNETs in TGM exhibit the molecular phenotype of developing neurons or neuronal progenitor cells. Although many factors could influence the phenotype of these experimental PNETs (e.g., promoter, site of integration of the transgene) these PNETs appear to be suitable TGM models of human PNETs of the central nervous system.

Adrenal Gland Neoplasms↗

Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice.

Brain (CATH.a) and adrenal (PATH.1 and PATH.2) cell lines have been established that synthesize abundant dopamine and norepinephrine and express the appropriate catecholaminergic biosynthetic enzymes, tyrosine hydroxylase (TH) and dopamine beta-hydroxylase. The lines were derived from TH-positive tumors in transgenic mice carrying the SV40 T antigen oncogene under the transcriptional control of 773 base pairs of 5' flanking sequences from the rat TH gene. Although the lines continue to express T antigen, they exhibit neuronal properties such as neurofilaments and synaptophysin and lack glial intermediate filaments. Although in vivo TH is only expressed in postmitotic neurons in the CNS, the CATH.a line demonstrates that TH expression and continued cell division are not incompatible after oncogenic transformation.

Adrenal Glands↗

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.

Adrenal Gland Neoplasms↗

Sequences that direct rat tyrosine hydroxylase gene expression.

Investigation of neuroendocrine genes has revealed that transcription is regulated via multiple DNA binding sites, including the cyclic AMP response element (CRE). We show here that for the neuronal and chromaffin-specific gene tyrosine hydroxylase (TH), a 70-bp region (-229 to -160) lacking the CRE is sufficient, in either orientation, to confer levels of chloramphenicol acetyltransferase reporter expression equivalent to or greater than that conferred by 4.8 kb of the rat TH enhancer/promoter region. The 70-bp region contains potential binding sites for AP2, AP1, E2A/MyoD, and POU transcription factors, and functions when linked to the TH promoter, but not when joined to a heterologous RSV promoter. This demonstrates that promoter as well as enhancer elements are important for TH expression. In gel-shift assays, the 70-bp fragment forms a cell type-specific complex with nuclear extracts from TH-expressing cells. which is effectively competed by an oligonucleotide containing AP2, AP1, and E2A/MyoD (E box) sites, but not by one containing the POU site. These data suggest that the AP2, AP1, and/or E box sites may be involved in forming the cell-specific complex. Although it lacks an authentic CRE, the 70-bp region also mediated a twofold transcriptional response to forskolin, equivalent to that found with the endogenous gene. A different region (-60 to -29) bearing a consensus CRE mediated a sixfold increase in transcription in response to forskolin, but only minimally activated basal transcription from the TH promoter in the absence of forskolin.

Animals↗

5' flanking sequences of the rat tyrosine hydroxylase gene target accurate tissue-specific, developmental, and transsynaptic expression in transgenic mice.

Transgenic mice were generated in which sequences that flank the rat tyrosine hydroxylase (TH) gene were linked to the bacterial chloramphenicol acetyl transferase (CAT) gene. Mice bearing 4.8 kilobases (kb) of 5' flanking DNA exhibited correct tissue-specific expression in the CNS and periphery. Expression was more robust in the CNS than in the periphery, although CAT activity was clearly detected in sympathetic ganglia (superior cervical ganglia) and the adrenal, the two peripheral tissues that contain TH-positive cells. Within the brain, CAT expression was seen in all the expected areas containing TH-positive cell bodies, with little or no expression in other regions. In the olfactory bulb, which contains the majority of the CNS TH cells, developmental expression of CAT was quantifiable and was found to parallel the postnatal rise in endogenous TH, with both TH and CAT reaching adult levels by postnatal day 21. Since TH activity in the olfactory bulb requires afferent input, the dependence of CAT activity on transsynaptic input was also assayed in transgenic mice. Like the endogenous TH activity, CAT levels were also reduced by deafferentation, in parallel with loss in endogenous dopamine levels. While previous experiments demonstrated that shorter 5' flanking regions (2.5 kb and 3.5 kb of 5' upstream sequences of the human and mouse TH gene, respectively) failed to direct accurate tissue-specific expression, our data demonstrate that 4.8 kb of 5' flanking sequence of the rat TH gene contains sufficient regulatory information to mediate appropriate tissue-specific expression in all CNS and PNS tissues, as well as to mediate developmental and transsynaptic expression in the olfactory bulb.

Animals↗