Search PubMed⌕ Search

Biomedical subjects

D J Smith

Publications and source records attributed to D J Smith.

At least 37 records · Page 2Linked to original sources
PubMed2003

Stereoselectivity of porcine beta-adrenergic receptors for ractopamine stereoisomers.

Ractopamine HCl is a beta-adrenergic receptor ((betaAR) ligand approved for use in swine to enhance carcass leanness. Ractopamine is produced commercially as a mixture of four stereoisomers (RR, RS, SR, SS). In order to determine which stereoisomers are active in the pig and whether they exhibit betaAR subtype selectivity, receptor affinity and adenylyl cyclase activation were determined using cloned porcine beta1- and beta2AR expressed in Chinese hamster ovary (CHO) cells. Dissociation constants (Kd) were determined by competitive displacement of [125I]iodocyanopindolol binding by ractopamine stereoisomers. The RR isomer had the highest affinity for both beta1- and betaAR (Kd of 29 and 26 nM, respectively). Dissociation constants for the other stereoisomers were higher (RS = 463 and 78 nM, SR = 3,230 and 831 nM, SS = 16,600 and 3,530 nM for the beta1- and beta2AR, respectively) relative to the RR stereoisomer. Isoproterenol stimulated adenylyl cyclase activity 600% relative to basal rates in CHO cells, regardless of betaAR subtype. Ractopamine stereoisomers did not significantly (P > 0.05) stimulate adenylyl cyclase through the beta1AR at moderate (near Kd) or high (10(-4) M) concentrations. In contrast, the RR isomer increased adenylyl cyclase activity 200 to 300% relative to basal rates through the beta2AR at moderate and hiconcentrations; the SR stereoisomer increased adenylyl cyclase activity nearly 100%. Neither the RS nor SS stereoisomers were effective in activating adenylyl cyclase activity through the beta2AR. A pattern of stereoselective activation similar to that for adenylyl cyclase also was exhibited for lipolysis using porcine adipocytes. The RR stereoisomer was equal to isoproterenol in stimulating lipolysis, whereas the SR isomer was 50% as effective; the RS and SR stereoisomers did not stimulate lipolysis in porcine adipocytes. The porcine betaAR exhibited stereoselectivity toward ractopamine stereoisomers with the RR isomer exhibiting the highest affinity for the (beta1- and beta2AR. In contrast, ractopamine stereoisomers seemed to be more effective at eliciting adenosine cyclic 3',5'-phosphate responses from beta2AR than beta1AR. The RR isomer ilikely the functional stereoisomer of ractopamine, but its effectiveness may be compromised by the presence of competing isomers, in particular the RS stereoisomer.

Adenylyl Cyclases↗
PubMed2003

Beta-adrenergic receptor subtypes that mediate ractopamine stimulation of lipolysis.

Ractopamine HCl is an beta-adrenergic receptor (betaAR) ligand that was recently approved for use in swine to enhance carcass leanness. The RR stereoisomer of ractopamine is the most active of the four stereoisomers exhibiting the highest affinity and signaling response. The RR isomer exhibits selective activation of the porcine beta2AR, which might limit the lipolytic response to ractopamine because the betaAR is the predominant subtype in swine adipocytes and may mediate most of the lipolytic response. Therefore, we determined the betaAR subtypes that mediate the lipolytic response to ractopamine in swine adipocytes. In order to confirm the predominant role of the beta1AR in porcine adipocytes, isoproterenol-stimulated lipolysis was inhibited by increasing doses of subtype-selective antagonists. Inhibition curves were biphasic using beta1AR antagonists (CGP 20712A and bisoprolol) and curve analysis indicated that both beta1AR an beta2AR contributed to lipolysis with 50 to 60% of the response coming from the beta1AR. Inhibition with the beta2AR antagonist clenbuterol revealed only one class of betaAR that closely approximated the kinetics of the beta1AR. When the RR isomer of ractopamine was the lipolytic agent, similar results to isoproterenol were observed, except that the estimated contribution of the beta1AR was 38%. That beta2AR antagonists did not detect a contribution of the beta2AR to lipolysis may indicate that the beta1AR masked the response to the beta2AR. Dose titration with the RR isomer in the presence of a saturating concentration of beta1AR or beta2AR antagonists indicated that each subtype was present in sufficient quantities to stimulate lipolysis near maximally. Data indicate that both the beta1AR and beta2AR are functionally linked to lipolysis in swine adipocytes and that ractopamine activates each subtype. The RR isomer of ractopamine stimulated adenosine 3',5'-cyclic phosphate accumulation with equal efficacy to isoproterenol through the cloned porcine beta2AR, but was only 35% as efficacious through the cloned porcine beta1AR. These data confirm the beta2AR selectivity of the RR stereoisomer, but suggest the partial agonism through the beta1AR is sufficient to activate lipolysis through both subtypes in swine adipocytes.

Adipocytes↗
PubMed2002

Low-temperature epitaxial growth of the quaternary wide band gap semiconductor SiCAlN.

Two compounds SiC and AlN, normally insoluble in each other below approximately 2000 degrees C, are synthesized as a single-phase solid-solution thin film by molecular beam epitaxy at 750 degrees C. The growth of epitaxial SiCAlN films with hexagonal structure takes place on 6H-SiC(0001) substrates. Two structural models for the hexagonal SiCAlN films are constructed based on first-principles total-energy density functional theory calculations, each showing agreement with the experimental microstructures observed in cross-sectional transmission electron microscopy images. The predicted fundamental band gap is 3.2 eV for the stoichiometric SiCAlN film.

Journal Article↗
PubMed2002

Visuospatial memory and learning in first-episode schizophreniform psychosis and established schizophrenia: a functional correlate of hippocampal pathology?

BACKGROUND: Despite a number of studies that have indicated impaired memory function in patients with schizophrenia, there have been few that have used a sensitive measure of right medial temporal lobe pathology. Given the reported findings of reduced hippocampal volume in schizophrenia, we used a theoretically sensitive test of the right medial temporal lobe to determine the nature of the visuospatial memory deficit in the disorder. METHODS: Seventy-six patients (37 with a first-episode schizophreniform psychosis, and 39 with established schizophrenia) were compared with 41 comparison subjects on a number of tests of visuospatial memory. These included spatial working memory, spatial and pattern recognition memory and a pattern-location associative learning test. RESULTS: Both patient groups displayed recognition memory deficits when compared to the comparison group. However, only those patients with established schizophrenia (of 9 years duration on average) were impaired on the associative learning test. CONCLUSIONS: The results indicate either a progressive decline in visuospatial associative learning ability over the course of the disorder, or that poor visuospatial associative learning is a marker for poor prognosis. In addition, these results have implications for our understanding of the role of the right medial temporal lobe in the pathophysiology of schizophrenia.

Adolescent↗
PubMed2002

Causes of ambient toxicity in the Calleguas Creek watershed of southern California.

A combination of toxicity tests, chemical analyses, and Toxicity Identification Evaluations (TIEs) were used to investigate receiving water toxicity in the Calleguas Creek watershed of southern California. Studies were conducted from 1995 through 1999 at various sites to investigate causes of temporal variability of toxicity throughout this system. Causes of receiving water toxicity varied by site and species tested. Investigations in the lower watershed (Revolon Slough, Santa Clara Drain, Beardsley Wash) indicated that toxicity of samples to the cladoceran Ceriodaphnia dubia was due to elevated concentrations of the organophosphate pesticide chlorpyrifos, while causes of intermittent toxicity to fathead minnows (Pimephales promelas) and the alga Selanastrum capricornutum were less clear. Investigations at sites in the middle and upper reaches of the watershed (Arroyo Simi and Conejo Creek) indicated that the pesticide diazinon was the probable cause of receiving water toxicity to Ceriodaphnia. Elevated ammonia was the cause of toxicity to fathead minnows in the upper watershed sites. Results of these and previous studies suggest that biota are impacted by degraded stream quality from a variety of point and non-point pollution sources in the Calleguas Creek watershed. Water quality resource manager's efforts to identify contaminant inputs and implement source control will be improved with the findings of this study.

Ammonia↗
PubMed2002

Incidental radiological findings on brain magnetic resonance imaging in first-episode psychosis and chronic schizophrenia.

OBJECTIVE: To investigate whether patients with first-episode psychosis or chronic schizophrenia have an increased incidence of magnetic resonance imaging (MRI) brain abnormalities compared with control subjects. METHOD: Totally 340 clinical MRI reports [Controls (n=98), first-episode psychoses (n=152), chronic schizophrenia (n=90)] were reported by a neuroradiologist blind to diagnosis and subsequently categorized using referral criteria (immediate, urgent, routine or no referral). RESULTS: Thirty percent of all scans were reported by a neuroradiologist as abnormal, but the majority required no referral. Patients with chronic schizophrenia were more likely to have clinically significant abnormal scans than patients with first episode psychosis or control subjects. In four patients the MRI findings led to the discovery of previously unsuspected pathology. CONCLUSION: Patients with chronic schizophrenia have an increased prevalence of incidental brain abnormalities. A small proportion of patients with chronic schizophrenia and first-episode psychosis benefitted directly from MRI scanning.

Adult↗
PubMed2002

Metabolic bone disease is present at diagnosis in patients with inflammatory bowel disease.

AIM: To establish whether bone disease is present at diagnosis in inflammatory bowel disease and to identify contributory metabolic abnormalities. METHODS: Newly diagnosed patients with inflammatory bowel disease (19 males, 15 females; mean age, 44 years; range, 17-79 years; 23 ulcerative colitis, 11 Crohn's disease) were compared against standard reference ranges and a control group with irritable bowel syndrome (eight males, 10 females; mean age, 40 years; range, 19-64 years). Bone mineral density (g/cm2, dual-energy X-ray absorptiometry: lumbar spine and femoral neck) and biochemical bone markers were measured. RESULTS: Femoral neck bone mineral density, T- and Z-scores (mean +/- s.d., respectively) were lower in inflammatory bowel disease patients than in irritable bowel syndrome controls (0.78 +/- 0.12 vs. 0.90 +/- 0.16, P = 0.0046; - 0.88 +/- 0.92 vs. 0.12 +/- 1.17, P = 0.0018; - 0.30 +/- 0.89 vs. 0.61 +/- 1.10, P = 0.0030). Lumbar spine bone mineral density and T-scores were also significantly lower in patients than controls (0.98 +/- 0.15 vs. 1.08 +/- 0.13, P = 0.0342; - 1.05 +/- 1.39 vs. - 0.14 +/- 1.19, P = 0.0304). Compared with controls, the urinary deoxypyridinoline : creatinine ratio was increased (7.66 vs. 5.70 nmol/mmol, P = 0.0163) and serum 25-hydroxy vitamin D was decreased (18.7 vs. 28.5 micro g/L, P = 0.0016); plasma osteocalcin and serum parathyroid hormone did not differ (P > 0.05). CONCLUSIONS: The bone mineral density is reduced at diagnosis, prior to corticosteroid treatment, in both Crohn's disease and ulcerative colitis. Our data suggest that this is attributable to increased resorption rather than decreased bone formation.

Adolescent↗
PubMed2002

Dental caries vaccines: prospects and concerns.

Dental caries remains one of the most common infectious diseases of mankind. Cariogenic micro-organisms enter the dental biofilm early in life and can subsequently emerge, under favorable environmental conditions, to cause disease. In oral fluids, adaptive host defenses aroused by these infections are expressed in the saliva and gingival crevicular fluid. This review will focus on methods by which mucosal host defenses can be induced by immunization to interfere with dental caries caused by mutans streptococci. The natural history of mutans streptococcal colonization is described in the context of the ontogeny of mucosal immunity to these and other indigenous oral streptococci. Molecular targets for dental caries vaccines are explored for their effectiveness in intact protein and subunit (synthetic peptide, recombinant and conjugate) vaccines in pre-clinical studies. Recent progress in the development of mucosal adjuvants and viable and non-viable delivery systems for dental caries vaccines is described. Finally, the results of clinical trials are reviewed, followed by a discussion of the prospects and concerns of human application of the principles presented.

Bacterial Proteins↗
PubMed2002

Tissue residues of ractopamine and urinary excretion of ractopamine and metabolites in animals treated for 7 days with dietary ractopamine.

Ractopamine HCl is a beta-adrenergic leanness-enhancing agent recently approved for use in swine. Depletion of ractopamine in tissues, and elimination of ractopamine and its metabolites in urine, is of interest for the detection of off-label use. The objectives of this study were to measure the residues of ractopamine in livers and kidneys of cattle (n = 6), sheep (n = 6), and ducks (n = 9) after treatment with dietary ractopamine for seven (sheep, ducks) or eight (cattle) consecutive days and to measure the depletion of ractopamine from urine of cattle and sheep. Two cattle and sheep and three ducks were each slaughtered with withdrawal periods of 0, 3, and 7 d. Urine samples were collected daily from cattle and sheep. Tissue ractopamine concentrations were determined using the regulatory method (FDA approved) for ractopamine in swine tissues. Ractopamine residues in urine samples were measured before and after hydrolysis of conjugates. Analysis was performed with HPLC using fluorescence detection after liquid- (hydrolyzed samples) and(or) solid-phase extraction. No residues were detected in duck tissues. Liver residues in sheep averaged 24.0 and 2.6 ppb after 0- and 3-d withdrawal periods, respectively. Sheep liver residues after a 7-d withdrawal period were less than the limit of quantification (2.5 ppb). Sheep kidney residues were 65.1 and undetectable at 0- and at 3- and 7-d, withdrawal periods, respectively. Cattle liver residues were 9.3, 2.5, and undetectable after 0-, 3-, and 7-d withdrawal periods, respectively; kidney residues were 97.5, 3.4, and undetectable at the same respective withdrawal periods. Concentrations of parent ractopamine in sheep urine were 9.8+/-3.3 ppb on withdrawal d 0 and were below the LOQ (5 ppb) beyond the 2-d withdrawal period. After the hydrolysis of conjugates, ractopamine concentrations were 5,272+/-1,361 ppb on withdrawal d 0 and 178+/-78 ppb on withdrawal d 7. Ractopamine concentrations in cattle urine ranged from 164+/-61.7 ng/mL (withdrawal d 0) to below the LOQ (50 ppb) on withdrawal d 4. After the hydrolysis of conjugates in cattle urine, ractopamine concentrations were 4,129+/-2,351 ppb (withdrawal d 0) to below the LOQ (withdrawal d 6). These data indicate that after the hydrolysis of conjugates, ractopamine should be detectable in urine of sheep as long as 7 d after the last exposure to ractopamine and as long as 5 d after withdrawal in cattle.

Adrenergic beta-Agonists↗
PubMed2002

Technical note: epimerization of ergopeptine alkaloids in organic and aqueous solvents.

Purified ergopeptine alkaloids are often used in studies related to tall fescue toxicosis without regard to epimerization that occurs when ergopeptines are solvated. The objectives of this study were to measure the rates of alpha-ergocryptine epimerization to alpha-ergocryptinine at room temperature and at -40 degrees C, and to measure the rate of ergovaline epimerization to ergovalinine at 37 degrees C. Alpha-ergocryptine tartrate was stable (< 0.5% epimerization) in protic or aprotic solvents when stored at -40 degrees C for 20 to 52 d. At room temperature, alpha-ergocryptine epimerization in chloroform did not occur; epimerization was modest in acetone and acetonitrile (< 5%) but was substantial in methanol (78% by 38 d) and in a 70:30 water methanol mix (47% by 42 d). Ergovaline epimerization to ergovalinine occurred at 37 degrees C in 0.1 M phosphate buffers (pH 3, 7.5, and 9) in 9% aqueous solutions of fetal bovine serum (FBS), and in water, methanol, and acetonitrile. The degree of epimerization at 37 degrees C was solvent-dependent. Epimerization rates with respect to time were roughly linear in phosphate buffer (pH 3 only), water, methanol, and acetonitrile; epimerization rates resembled first-order kinetics in phosphate buffers (pH 7.5 and 9) and in the presence of FBS (pH 3, 7.5 and in Dulbecco's culture media). Epimerization equilibria (48 to 63% ergovaline) were reached within approximately 1 to 19 h. Results from this study indicate that researchers conducting studies with purified ergopeptines should carefully control the storage conditions of solvated ergopeptines and measure isomeric composition under the actual experimental conditions used in experiments.

Animal Feed↗
PubMed2001

Synthesis of silicon-based infrared semiconductors in the Ge-Sn system using molecular chemistry methods.

Growth reactions based on a newly developed deuterium-stabilized Sn hydride [(Ph)SnD(3)] with Ge(2)H(6) produce a new family of Ge-Sn semiconductors with tunable band gaps and potential applications in high-speed, high-efficiency infrared optoelectronics. Metastable diamond-cubic films of Ge(1-x)Sn(x) alloys are created by chemical vapor deposition at 350 degrees C on Si(100). These exhibit unprecedented thermal stability and superior crystallinity despite the 17% lattice mismatch between the constituent materials. The composition, crystal structure, electronic structure, and optical properties of these materials are characterized by Rutherford backscattering, high-resolution electron microscopy, and X-ray diffraction, as well as Raman, IR, and spectroscopic ellipsometry. Electron diffraction reveals monocrystalline and perfectly epitaxial layers with lattice constants intermediate between those of Ge and alpha-Sn. X-ray diffraction in the theta-2theta mode shows well-defined peaks corresponding to random alloys, and in-plane rocking scans of the (004) reflection confirm a tightly aligned spread of the crystal mosaics. RBS ion-channeling including angular scans confirm that Sn occupies substitutional lattice sites and also provide evidence of local ordering of the elements with increasing Sn concentration. The Raman spectra show bands corresponding to Ge-Ge and Sn-Ge vibrations with frequencies consistent with random tetrahedral alloys. Resonance Raman and ellipsometry spectra indicate a band-gap reduction relative to Ge. The IR transmission spectra suggest that the band gap decreases monotonically with increasing Sn fraction. The synthesis, characterization, and gas-phase electron diffraction structure of (Ph)SnD(3) are also reported.

Journal Article↗
PubMed2001

Selective bilateral hippocampal volume loss in chronic schizophrenia.

BACKGROUND: The hippocampus is implicated in the pathophysiology of schizophrenia; however, volumetric changes are subtle and have limited diagnostic specificity. It is possible that the shape of the hippocampus may be more characteristic of schizophrenia. METHODS: Forty-five patients with chronic schizophrenia and 139 healthy control subjects were scanned using magnetic resonance imaging. Hippocampi were traced manually, and two-dimensional shape information was analyzed. RESULTS: Two shape factors were found to be adequate to represent variance in the shape of the hippocampus. One of these factors, representing volume loss behind the head of the hippocampus, provided a degree of discrimination between patients with chronic schizophrenia and healthy control subjects; however, overall hippocampal volume following appropriate adjustment for brain volume showed a similar level of discrimination. Patients with chronic schizophrenia were best characterized using these two measures together, but diagnostic specificity was only moderate. CONCLUSIONS: This study identified that less of the hippocampus was distributed in its posterior two-thirds in patients with chronic schizophrenia, and specifically in the region just posterior to the hippocampal head. Group discrimination on the basis of hippocampal volume and shape measures was moderately good. A full three-dimensional analysis of hippocampal shape, based on large samples, would be a useful extension of the study.

Adolescent↗
PubMed2001

A longitudinal study of hippocampal volume in first episode psychosis and chronic schizophrenia.

Brain abnormalities have been identified in patients with schizophrenia, but what is unclear is whether these changes are progressive over the course of the disorder. In this longitudinal study, hippocampal and temporal lobe volumes were measured at two time points in 30 patients with first episode psychosis (mean follow-up interval=1.9 years, range 0.54-4.18 years) and 12 with chronic schizophrenia (mean follow-up interval=2.3 years, range 1.03-4.12 years) and compared to 26 comparison subjects (mean follow-up interval 2.2 years, range 0.86-4.18 years). Hippocampal, temporal lobe, whole-brain and intracranial volumes (ICV) were estimated from high-resolution magnetic resonance images. Only whole-brain volume showed significant loss over the follow-up interval in both patient groups. The rate of this volume loss was not different in the first episode group compared to the chronic group. There were no changes in either hippocampal or temporal lobe volumes. The negative findings for the hippocampus and temporal lobes may mean that the abnormalities in these regions are stable features of schizophrenia. Alternatively, the period before the onset of frank psychotic symptoms may be the point of greatest risk for progressive change.

Adolescent↗
PubMed2001

Cloning and characterization of a canine UDP-glucuronosyltransferase.

UDP-glucuronosyltransferases (UGTs) are a major family of enzymes catalyzing the transfer of glucuronic acid to a range of endogenous compounds and xenobiotics facilitating their elimination in either urine or bile. Although the dog is commonly used in drug metabolism studies, relatively little is known about the expression and activity of UGTs in this species. This report describes the molecular cloning and functional characterization of the first dog UGT, UGT1A6. The cloned protein is composed of 528 amino acids with the variable region demonstrating a 67-72% identity with the variable regions of mouse, rat, and human UGT1A6. The enzyme expressed stably in V79 cells predominantly catalyzed the glucuronidation of simple, planar phenols (e.g., for 1-naphthol, K(m) = 41 microM, V(max) = 0.07 nmol/min/mg protein), a class of compounds extensively glucuronidated by human UGT1A6. Based on sequence homology and common catalytic activity, this dog UGT1A protein appears to be the canine orthologue of human UGT1A6.

Amino Acid Sequence↗
PubMed2001

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

Adjuvants, Immunologic↗
PubMed2001

Understanding the mechanism of ice binding by type III antifreeze proteins.

Type III antifreeze proteins (AFPs) are present in the body fluids of some polar fishes where they inhibit ice growth at subzero temperatures. Previous studies of the structure of type III AFP by NMR and X-ray identified a remarkably flat surface on the protein containing amino acids that were demonstrated to be important for interaction with ice by mutational studies. It was proposed that this protein surface binds onto the (1 0 [\bar 1] 0) plane of ice with the key amino acids interacting directly with the water molecules in the ice crystal. Here, we show that the mechanism of type III AFP interaction with ice crystals is more complex than that proposed previously. We report a high-resolution X-ray structure of type III AFP refined at 1.15 A resolution with individual anisotropic temperature factors. We report the results of ice-etching experiments that show a broad surface coverage, suggesting that type III AFP binds to a set of planes that are parallel with or inclined at a small angle to the crystallographic c-axis of the ice crystal. Our modelling studies, performed with the refined structure, confirm that type III AFP can make energetically favourable interactions with several ice surfaces.

Amino Acid Sequence↗
PubMed2001

Distinct ligand binding properties of Mac-2-binding protein and mouse cyclophilin [correction of mousephilin] C-associated protein.

Human Mac-2-binding protein (Mac-2-BP) is a secreted glycoprotein that is widely expressed. It binds to the human macrophage-associated lectin Mac-2 and has been suggested to have a role in host defence. Mouse cyclophilin C-associated protein (mCyCAP) is also a secreted glycoprotein that binds with high affinity to cyclophilin C in the absence of the immunosuppressive drug cyclosporin A. The two proteins share a similar domain structure and considerable sequence identity, including a highly conserved scavenger receptor cysteine-rich domain, and both of them exert their function within the immune system. To elucidate whether these molecules are also functional homologues, we compared their ligand binding properties using cell lines which express Mac-2-BP or mCyCAP as well as transfected cell lines stably expressing mCyCAP or a mutant version lacking the scavenger domain. These experiments show that Mac-2-BP is unable to bind to either human or mouse cyclophilin C and thatmCyCAP cannot bind to Mac-2. The scavenger domain is not required for the interaction between mCyCAP and cyclophilin C. We conclude that these proteins may be part of a larger family of proteins of immunological importance in which closer functional homologues might exists.

Animals↗