Search PubMed⌕ Search

Biomedical subjects

D G Knorre

Publications and source records attributed to D G Knorre.

At least 19 recordsLinked to original sources
PubMed2001

Location of template on the human ribosome as revealed from data on cross-linking with reactive mRNA analogs.

In this review we summarize data on the location of template on the human ribosome that we obtained from cross-linking (affinity labeling) experiments using reactive mRNA analogs. Types of mRNA analogs, model complexes of these analogs with 80S ribosomes, and methods for analysis of the ribosomal components (proteins and rRNA nucleotides) cross-linked with the mRNA analogs are reviewed. From analysis of the cross-linking data, we suggest a scheme for the arrangement of mRNA on the human ribosome and compare the organization of the mRNA binding center on human and Escherichia coli ribosomes.

Affinity Labels↗
PubMed2000

[The synthesis of a cobalt(II) tetracarboxyphthalocyanine- deoxyribooligonucleotide conjugate as a reagent for the directed DNA modification].

The cobalt(II) tetracarboxyphthalocyanine-deoxyribonucleotide pd(TCTTCCCA) conjugate was synthesized. The phthalocyanine N-succinimide ester prepared from phthalocyanine using DCC was mixed in DMF with an aqueous solution of the oligonucleotide bearing a 1,3-diaminopropane linker at the 5'-phosphate. The resulting conjugate was tested in the intraduplex reaction with target 14-mer and 22-mer oligonucleotides containing conjugate-complementary sequences. In the presence of O2 and a thiol (2-mercaptoethanol or DTT) as a coupled reducer or H2O2, sequence-specific DNA modification was observed that caused the cleavage of the target upon treatment with piperidine.

Animals↗
PubMed1999

Real-time oligonucleotide hybridization kinetics monitored by resonant mirror technique.

The kinetics of hybridization of 11-meric and 14-meric oligonucleotides, dTGGGAAGAGGG (ODN-11) and dTGGGAAGAGG GTCA (ODN-14), with 14-meric oligonucleotide dpTGACCCTCT TCCCA (p14) attached to the surface of a cuvette was studied by the resonant mirror method. The treatment of the experimental curves with exponential equations leads to the following values for association (kas) and dissociation (kdis) rate constants at 25 degrees C: kas = 219 +/- 39 and 183 +/- 162 M-1 s-1, kdis = (2.0 +/- 0.4) x 10(-3) and (4 +/- 1) x 10(-4) s-1 for the duplexes (p14) x (ODN-11) and p14 x (ODN-14), respectively. The oligonucleotide dTGCCTTGAATGGGAA GAGGGTCA (ODN-23), which forms a hairpin structure, does not associate with p14. The data were compared with the results of melting curve detection and temperature-jump experiments. The association rate constants for ODN-11 and ODN-14 are much slower than those values in homogeneous aqueous solution. The dissociation rate constants have the same magnitude values as estimated by using association constants measured from melting curves but differ from the values estimated in temperature-jump experiments.

Biosensing Techniques↗
PubMed1998

Photoaffinity labeling as an approach to study supramolecular nucleoprotein complexes.

The modern approaches for studying the detailed structure of nucleoprotein complexes involved in replication and transcription, based on the use of nucleic acids with photoreactive groups incorporated into definite positions of polynucleotide chain, are considered. Methods of preparation of photoreactive nucleic acids of this type are presented. Their use for positioning of RNA polymerase III and transcription factors as well as of the main participants of the replication machinery at the respective templates is described. A survey of the data concerning the amino acid residues modified in the course of photoaffinity labeling of proteins is also presented and some complications are discussed.

Affinity Labels↗
PubMed1998

[New approach to the study of interaction of amino acid side groups with aryl azides].

A new approach to the study of the interaction of amino acid side chains with photoreactive aryl azides was proposed. This approach was based on the drawing together of the reacting groups by the attachment of the reacting compounds to complementary oligonucleotides. Cystamine, histamine, and 1,6-hexamethylenediamine mimicking the cystine, histidine, and lysine residues, respectively, were attached to the 3'-terminal phosphate of the oligonucleotide GGTATCp through a phosphamide bond and used as the targets for photomodification. Derivatives of the oligonucleotide pGATACCAA with the fragment N3C6H4NH- attached directly to its 5'-end by a phosphamide bond or through the spacer -(CH2)nNH- (where n is 2, 4, and 6) were used as photoreagents. Their derivatives containing the same spacer and the N3C6F4CO-NH(CH2)3NH- or 2-N3,5-NO2-C6H3CO-NH(CH2)3NH- residues were also used. The duplexes were photomodified by irradiation with 300-350 nm wavelength light. The maximal yields of the photo-cross-linking were from 22 to 68%. The reagents containing p-azidoaniline residue were found to be the most effective toward the targets. The maximum yields of the photomodification products modeling the side chains of cysteine and lysine were found to vary from 40 to 67% and to depend on the length and the structure of the spacers used. The duplex with the target bearing the imidazole residue (the histidine model) manifested a yield decreased to 25%. This fact was in a good agreement with the data of computer modeling that indicated an unfavorable mutual displacement of the imidazole residue and the photoreactive group.

Amino Acids↗
PubMed1997

Cooperative interactions of the oligodeoxyribonucleotides on the complementary template. The influence of chemical groups and mismatched nucleotides at the 5'- and 3'-ends of oligonucleotides on the parameters of cooperativity.

Parameters of cooperative interactions of two or three oligodeoxyribonucleotides or their derivatives bound with the adjacent sites of the complementary template were measured using method of "complementary addressed modification titration" (CAMT). Complementary template (target) were modified with the reactive oligonucleotide derivatives (reagents) bearing covalently attached alkylating 4-[N-(2-chloroethyl)-N-methylamino]benzylamino- group (C1RCH2NH)- at 5'-terminal phosphate. The targets had only one binding site for the reagent and either no (T10), or one (T'22 and T22) or two sites (T26) for the oligonucleotides (effectors) cooperatively bound with the adjacent sites on the template. Both unmodified oligonucleotides E1, E2 and their derivatives E1Phn, E2Phn bearing N-(2-hydroxyethyl)-phenazinium residues Phn- both at 5'- and 3'-ends covalently linked via ethylenediamine linker were used as effectors. Effectors E1 and E2 (E1Phn and E2Phn) bind, respectively, upstream or downstream from the reagent. Hexameric (X6) or octameric (X8 or X8m) reagents were used for the target modification. The reagent X8m formed one TT-mismatch with the target at the end opposite to location of the reactive moiety. The cooperativity parameter values characterizing the mutual interactions between the reagents X6, X8, X8m and effectors E1, E2, E1Phn, E2Phn have been found as the ratio of the association constants of the reagents in the presence of effectors. The association constants were calculated from the dependencies of the target modification extent on initial concentrations of the reagents. The use of T26 existing both in linear and hairpin conformations permitted us to estimate additionally the role of indirect cooperativity originating from the induction of the target conformational change by the effectors. The following conclusions were done from the quantitative results. The efficiency of direct cooperativity is independent on the length of oligonucleotide for the same nature of the contact. The cooperativity parameter increases by factor about 3 in the presence of Phn-group covalently attached to oligonucleotides and located at the junctions. The presence of either alkylating group C1RCH2NH- or TT-mismatch at the junctions eliminates cooperative interaction between the bases. In the same time sufficiently effective cooperative interaction takes place in the case of simultaneous presence of both Phn- and either C1RCH2NH- group or TT-mismatch at the junction.

DNA, Complementary↗
PubMed1997

[Gene-directed biologically active substances (antisense oligonucleotides and their derivatives)].

Results of studies carried out over the last eight years under the Russian State Scientific and Technical Program "New Methods in Bioengineering" are reviewed. New addressing constructions formed by a tandem of two or more oligonucleotides on a target nucleic acid are described. The reactivity of the tandem is enhanced due to the stabilization of some components, either by attachment of polyaromatic systems (method of effectors) or by the formation of a reaction center, which occurs when the components of the active center draw together into a tandem. Reagents which are oligonucleotide derivatives are also described, in particular a derivative of the antibiotic bleomycin, which is capable of catalytic cleavage of the target. Evidence is presented that oligonucleotides interact with the proteins of cells and living organisms, including the receptor proteins discovered in the course of this research, the T-helper CD4 receptor, immunoglobulins, and some growth factors.

Base Sequence↗
PubMed1995

Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure.

The intraduplex reaction of the alkylating reagent CIRCH2NHpd(TTCCCA) (X, ClR is p-(N-2-chloroethyl-N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E1) and Phn-L-pd(TGACCCTC)p-L-Phy (E2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH2CH2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent + target) to calculate association constants of X with P, PE1, PE2 and PE1E2. The latter were found to be Kxe1 = 6.75 x 10(5) M-1, Kxe2 = 4.15 x 10(4) M-1 and Kxe12 = 5.87 x 10(6) M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4) M-1 in the absence of effectors. Taking into account the internal structure of the target, co-operativity parameters describing interactions in the tandem E1 x X x E2 arranged at the target were calculated as alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2.

Alkylating Agents↗
PubMed1995

Thermodynamic and structural features of cooperative interactions in tandem oligonucleotide derivatives arranged at the complementary template. Chemical modification data.

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.

Base Sequence↗
PubMed1993

Kinetic study of the addressed modification by hemin derivatives of oligonucleotides.

Kinetics of oligonucleotide pd(TGAATGGGAAGA) modification by a hemin derivative of the complementary oligonucleotide pd(TTCCCATT) in the presence of hydrogen peroxide was investigated. The treatment of experimental data permitted to evaluate the association and rate constants at 25 degrees C: Kx = (3.40 +/- 0.38) x 10(5) M-1 (association constant of the reagent with the target), kd = 152 +/- 6 M-1 min-1 (degradation constant of the hemin group of the reagent in a parallel reaction), ko = 51.0 +/- 1.7 M-1 min-1 (target modification constant in the reactive duplex). The modification of DNA is incomplete due to competition of the modification reaction with the degradation of the hemin group of the reagent in a parallel reaction.

Base Sequence↗
PubMed1992

The influence of the target structure on the efficiency of alkylation of single-stranded DNA with the reactive derivatives of antisense oligonucleotides.

Site-directed alkylation of three oligonucleotide targets: 41-mer (hairpin structure), 22-mer (loop part of this hairpin) and 10-mer (part of the loop) with 5'-p-(N-2-chloroethyl-N-methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at several temperatures. The stability of the complex increases significantly in the set: 302-mer carrying above hairpin, 41-mer, 22-mer, the data for 22-mer and 10-mer being nearly identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.

Alkylation↗
PubMed1992

Cell membranes as barriers for antisense constructions.

The results of studies on interaction of oligonucleotides and polynucleotides with cell membranes are reviewed. Oligonucleotides and polynucleotides bind to lipid membranes in the presence of divalent cations that may result in spontaneous encapsulation of nucleic acids and transfer of the formed vesicles to the other side of the membrane. Oligonucleotides can enter eukaryotic cells and interact with cellular RNA and DNA. On the surface of eukaryotic cells, there are proteins capable of binding to nucleic acids that may be involved in oligonucleotide uptake. Oligonucleotides bind to cellular CD4 receptors. Efficient delivery into cells can be achieved by conjugation of oligonucleotides to lipophilic groups or by encapsulation into membrane carriers.

Animals↗
PubMed1991

Reactive oligonucleotide derivatives as gene-targeted biologically active compounds and affinity probes.

Development of efficient methods for synthesis of oligonucleotides and oligonucleotide analogs has opened up the possibility of designing a broad spectrum of affinity reagents for specific modification of nucleic acids and proteins. These affinity reagents are used for investigation of the topology of ribosomes and nucleic acid polymerases. Oligonucleotides and their analogs are already used for suppression of specific gene expression and for elucidation of the physiological role of their products. Oligonucleotide derivatives appear to offer considerable promise as potential gene-targeted drugs such as antivirals and specific inhibitors of oncogene expression.

Affinity Labels↗
PubMed1990

Antisense oligonucleotide derivatives as gene-targeted drugs.

The strategies and problems involved in designing oligonucleotide derivatives as gene-targeted drugs are discussed. Experiments with isolated and cellular nucleic acids, studies with infected cell cultures, and preliminary animal tests all demonstrate that various derivatives of complementary oligonucleotides (antisense oligonucleotide derivatives) can act as extremely specific and potent inhibitors of gene expression. The design and synthesis of more stable oligonucleotide analogues that can enter mammalian cells and efficiently affect preselected nucleic acids will result in the development of a new generation of drugs, including those with antiviral and anticancer properties.

Animals↗
PubMed1988

Sequence-specific chemical modification of double-stranded DNA with alkylating oligodeoxyribonucleotide derivatives.

Chemical modification of double-stranded (ds) DNA with alkylating oligodeoxynucleotide (oligo) derivatives, 5'-p(N-2-chloroethyl-N-methylamino) benzylamides of oligos, has been investigated. In contrast to relaxed plasmid DNAs, the superhelical molecules interact with the oligo derivatives and specific alkylation of the DNAs occurs at the regions complementary to the oligo reagents. Alkylating derivatives of oligocytidylates and pT(pCpT)6 react with corresponding homopyrimidine-homopurine tracts within ds DNA fragments due to triple helix formation.

Alkylation↗
PubMed1988

N-(2-hydroxyethyl)phenazinium derivatives of oligonucleotides as effectors of the sequence-specific modification of nucleic acids with reactive oligonucleotide derivatives.

It has been found that mono- and especially diphenazinium derivatives of oligonucleotides complementary to the DNA sequence adjacent to the target sequence of the addressed alkylation of DNA, significantly enhance the extent and specificity of alkylation with p-(N-2-chloroethyl-N-methylamino)benzylamide derivatives of the addressing oligonucleotides, thus playing the role of effector of the sequence-specific (complementary addressed) modification.

Alkylation↗