Search PubMed⌕ Search

Biomedical subjects

D Eisen

Publications and source records attributed to D Eisen.

At least 37 records · Page 2Linked to original sources
PubMed1996

Probable new species of Desulfovibrio isolated from a pyogenic liver abscess.

A fastidious, slowly growing, spiral gram-negative bacterium was isolated from the liver abscess of an 82-year-old man with a 3-week history of febrile illness. The organism was an obligate anaerobe that grew at 37 and 42 degrees C but not at 25 degrees C. Its vibrioid or spiral morphology on Gram staining, rapid progressive motility, electron micrograph features, and biochemical tests were all consistent with the organism belonging to the genus Desulfovibrio. 16S rRNA gene sequencing of this organism demonstrated a 97% similarity to Desulfovibrio desulfuricans with 45 nucleotide differences, suggesting that it is a new species of Desulfovibrio.

Aged↗
PubMed1995

Random amplified polymorphic DNA and plasmid analyses used in investigation of an outbreak of multiresistant Klebsiella pneumoniae.

Multiresistant Klebsiella pneumoniae strains with plasmid-borne extended-spectrum beta-lactamases (ESBL) are increasingly frequent nosocomial pathogens. A major outbreak of clinical infections, mainly involving patients in the Newborn Services Unit with limited spread to adult patients, occurred at our hospital. This epidemic was investigated by typing the isolates phenotypically and with random amplified polymorphic DNA analysis (RAPD) and plasmid analysis. Forty-eight isolates, consisting of 44 consecutive clinical isolates and 4 selected surveillance isolates, were studied. A single decamer primer was used for the RAPD, and this was effective in demonstrating that the majority of isolates (45 of 48) had the same profile. Three other isolates had different RAPD patterns identifying them as nonepidemic strains. Plasmids were extracted by alkaline lysis with Magic-miniprep kits from 10 isolates selected to represent the epidemic and nonepidemic strains. This method produced small (< 20-kb) plasmids; larger ESBL-carrying plasmids were not produced, but the small plasmids nonetheless allowed strain differentiation. Antibiotic susceptibility patterns alone were not reliable as strain indicators, since some isolates with the RAPD pattern characteristic of the epidemic strains did not express ESBL and therefore were susceptible to extended-spectrum cephalosporins. The investigation showed the predominance of a single epidemic strain that was transmitted between patients in the Newborn Services Unit. RAPD was the best of the methods used for detecting strain differences, and its speed and ability to type a wide variety of species suggest that it will be an increasingly useful molecular epidemiologic tool.

Adult↗
PubMed1994

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

AIDS-Related Opportunistic Infections↗
PubMed1994

The vulvovaginal-gingival syndrome of lichen planus. The clinical characteristics of 22 patients.

BACKGROUND AND DESIGN: The vulvovaginal-gingival syndrome is a variant of mucosal lichen planus characterized by erosions and desquamation of the vulva, vagina, and gingiva. The clinical features of patients initially evaluated for vulvitis who exhibited the additional features of this syndrome have been described in one previous study. In the current study, 22 women with biopsy-proved oral lichen planus and clinical evidence of vulvovaginal lichen planus were examined and treated. This group of patients represents the largest reported series demonstrating the vulvovaginal-gingival syndrome. RESULTS: Gingival lichen planus, present in all patients, was characterized by erosions and erythema in 16 subjects and by white, reticulated lesions in six others. Vulvovaginal lichen planus also displayed erosions in the majority of patients. The response to a wide variety of therapeutic agents was satisfactory in most patients. However, concomitant use of several drugs was usually required to achieve beneficial results. CONCLUSIONS: Patients with oral lichen planus should be routinely examined for the presence of disease on other mucosal surfaces. The recognition of this syndrome, which is undoubtedly more common than previously reported, will avoid unnecessary delay in the treatment of these patients.

Adult↗
PubMed1993

Hydroxychloroquine sulfate (Plaquenil) improves oral lichen planus: An open trial.

BACKGROUND: Oral lichen planus is chronic and can be debilitating. Topical corticosteroids are most frequently used for treatment, but they are not always effective. OBJECTIVE: Hydroxychloroquine sulfate (Plaquenil), an antimalarial agent, was evaluated in an open trial (10 patients) for its ability to improve oral lichen planus. METHODS: Patients received hydroxychloroquine, 200 to 400 mg daily, as a monotherapy for 6 months. Patients were assessed at baseline and every 4 to 8 weeks during treatment. Baseline ophthalmologic examinations were performed, and laboratory values were monitored before and during treatment. RESULTS: Nine of ten patients had an excellent response to therapy. Three of six patients with erosions at baseline had complete healing. Pain relief and reduced erythema were usually observed after 1 to 2 months of therapy, but erosions required 3 to 6 months of treatment before they resolved. There were no adverse effects. CONCLUSION: Hydroxychloroquine may be useful in the treatment of oral lichen planus.

Administration, Oral↗
PubMed1993

The therapy of oral lichen planus.

Oral lichen planus is a chronic mucocutaneous disease that is relatively common. Although many patients are asymptomatic and require no therapy, those who exhibit atrophic and erosive lesions are often a challenge to treat. All therapies are palliative, and none is effective universally. Currently employed treatment modalities include corticosteroids administered topically, intralesionally, or systemically. Alternative therapies include topical and systemic retinoids, griseofulvin, Cyclosporine, and surgery. Other medical treatments and experimental modalities, including mouth PUVA, have been reported to be effective. Controversy concerning the efficacy of all these treatments suggests that oral lichen planus is a heterogeneous disorder. Eliminating lichenoid drug eruptions, candidiasis, trauma, contact mucositis, and emotional stress may play a role in the management of these patients. This article is a review of the many treatments and measures that have been employed in the management of patients with oral lichen planus.

Administration, Topical↗
PubMed1992

Intralesional cyclosporine for psoriasis. Relationship of dose, tissue levels, and efficacy.

UNLABELLED: BACKGROUND AND DESIGN--To avoid systemic side effects, topical and intralesional administration of cyclosporine has been used; however, only intralesional administration has been successful. To understand more about the dosing requirements and resultant tissue levels of intralesional cyclosporine, we injected psoriasis plaques in a double-blind fashion with three different concentrations of cyclosporine (17 mg/mL in seven patients, 10 mg/mL in 13 patients, and 2.5 mg/mL in 11 patients) or matching vehicle three times weekly for 4 weeks. RESULTS--Statistically significant improvement was observed in plaques treated with 17 mg/mL (P = .003) compared with vehicle-treated plaques; the improvements in plaques treated with 10 mg/mL (P = .078) and 2.5 mg/mL (P = .054) achieved marginal statistical significance compared with vehicle treatment. Four weeks after discontinuation of therapy, the change from pretherapy in plaques that had received 17 mg/mL of cyclosporine was statistically significantly better (P less than .0001) than that with vehicle treatment. A similar finding but of marginal statistical significance (P = .059) occurred in the plaques that had received 10 mg/mL of cyclosporine. Throughout the study, untreated psoriasis plaques did not improve. Transient pain was the most common side effect noted with both cyclosporine and vehicle injections. Tissue levels of cyclosporine tended to be highest in plaques receiving the 17-mg/mL concentration; blood levels of cyclosporine were low throughout the study. CONCLUSIONS: --Intralesional cyclosporine requires a sufficient dosage to improve psoriasis, apparently by a local mechanism of action. Improvement may persist for 4 weeks or longer.

Cyclosporine↗
PubMed1992

The oral mucosal punch biopsy. A report of 140 cases.

BACKGROUND: Dermatologists are often confronted with neoplasms and diseases of the oral cavity. Although many may be reluctant to perform oral surgical procedures, a biopsy is often needed to establish a definitive diagnosis. This article describes a simple and safe method of obtaining an oral biopsy specimen. OBSERVATIONS: A punch was used in performing 140 biopsies from various locations of the oral cavity. Bleeding was controlled by pressure in the majority of cases, with only a few requiring electrodesiccation. Biopsy sites, all of which were left to heal by secondary intention, showed almost complete reepithelialization at a 2-week postoperative check. Complications from surgery were almost nonexistent and minor in degree. CONCLUSIONS: The punch biopsy of the oral cavity is a safe and useful technique that can be easily employed by dermatologists. Biopsies should be kept superficial, and neurovascular structures must be avoided to prevent complications.

Biopsy↗
PubMed1991

Oral melanoma and other pigmented lesions of the oral cavity.

This article presents a review of oral malignant melanoma and other oral cavity pigmented lesions. The dismal prognosis for patients with oral malignant melanoma is partly due to patients' delayed recognition of signs of early disease and delayed diagnosis by physicians. Pigmented macules and plaques in the oral cavity, representing the radial growth phase of tumors, often go unrecognized for months or years before tumor invasion. Therefore, if early detection of thin oral melanomas is to be achieved, all pigmented oral cavity lesions should be viewed with suspicion. Biopsies of such lesions are indicated when the clinical diagnosis is uncertain. Prompt aggressive surgical treatment is essential in reducing the morbidity and mortality from oral melanomas. The differential diagnosis of oral melanomas includes nevi, oral melanotic macules, amalgam tattoos, Kaposi's sarcoma, oral melanoacanthoma, and physiologic pigmentation.

Acquired Immunodeficiency Syndrome↗
PubMed1991

Retinoic acid receptor gene expression in human skin.

Human skin exhibits a characteristic, pleiotypic response to topical retinoic acid. In attempting to understand this response at the molecular level, we have used fast protein liquid chromatography (FPLC) and RNA blot hybridization to characterize the expression of the nuclear retinoic acid receptor (RAR) alpha, beta, and gamma genes in adult human epidermis. Size exclusion FPLC of 0.6 M NaCl nuclear extracts prepared from keratome biopsies revealed two peaks of specific [3H] retinoic acid (RA) binding at Mr 45 and 18 kDa, in agreement with the expected sizes of RAR and cellular RA binding protein. Blot hybridization analysis of total RNA extracted from keratome biopsies revealed that RAR-gamma was the predominant RAR species expressed in human epidermis, as RAR-alpha transcripts were detectable only at low levels and RAR-beta transcripts were undetectable. RAR transcripts were not induced by topical treatment with 0.1% RA cream under occlusion for 4 h or 4 d. Moreover, there was no significant difference in RAR-gamma transcript levels in normal and psoriatic epidermis. RAR-gamma transcripts were constitutively expressed not only in cultured human keratinocytes, but also in human dermal and lung fibroblasts. RAR-beta was induced by RA in dermal fibroblasts, but not in keratinocytes. RA induced IL-1 beta transcripts in keratinocytes rapidly (2 to 4 h) and at low concentrations (3 x 10(-10) M), consistent with activation of the IL-1 beta gene via RAR. These results demonstrate constitutive expression of RAR-gamma in human epidermis, and suggest that RAR-gamma is a molecular target of RA action in adult human skin.

Blotting, Northern↗
PubMed1990

Effect of topical cyclosporine rinse on oral lichen planus. A double-blind analysis.

BACKGROUND: Oral lichen planus is a relatively common disorder of the mouth that can be debilitating. It is frequently palliated with topical or systemic corticosteroids and retinoids. These treatments require prolonged use, however, and are not always effective. METHODS: In a double-blind trial, 16 patients with symptomatic oral lichen planus were randomly assigned to receive either topical cyclosporine or its vehicle. The patients swished and expectorated 5 ml of medication (containing 100 mg of cyclosporine per milliliter) three times daily. RESULTS: After eight weeks, the eight recipients of cyclosporine had marked improvement in erythema (P = 0.003), erosion (P = 0.02), reticulation (presence of white lacelike lesions; P = 0.007), and pain (P = 0.002), whereas the eight recipients of vehicle had no change or minimal improvement. After a switch to cyclosporine for eight weeks, the vehicle-treated patients had improvement similar to that seen in the patients who initially received cyclosporine. There were no systemic side effects. In most cases blood cyclosporine levels were low or undertectable. Cyclosporine levels present in specimens of oral mucosa at the end of therapy four hours after the patients swished were similar to the levels previously reported in psoriatic lesions after treatment with systemic cyclosporine (14 mg per kilogram of body weight per day). CONCLUSIONS: As a topical preparation, cyclosporine may be useful in the treatment of oral lichen planus and possibly other cutaneous disorders.

Aged↗
PubMed1990

Topical cyclosporine for oral mucosal disorders.

Topical cyclosporine may be effective in the treatment of various oral mucosal disorders. In three open trials and in one double-blind study, a topical formulation of this drug produced significant improvement in oral lichen planus. Cyclosporine blood levels were generally low in these studies and no abnormalities of laboratory values resulted during use. Of six patients with oral bullous diseases treated with topical cyclosporine, four showed a decrease in erythema, partial healing of ulcerations, and a reduction in pain. Three patients relapsed shortly after cyclosporine was discontinued. Four of eight patients with persistent aphthous stomatitis remained virtually free of ulcers during 8 weeks of topical cyclosporine therapy. These results indicate that topical cyclosporine is beneficial as a therapy for oral lichen planus and possibly other mucosal diseases.

Administration, Topical↗
PubMed1987

Acid-active neuraminidases in the growth media from cultures of pathogenic Naegleria fowleri and in sonicates of rabbit alveolar macrophages.

Using bovine mucin and isolated human myelin as sources of sialic acid, we demonstrate the presence of neuraminidase activities in the growth media of pathogenic, but not nonpathogenic, Naegleria sp. and in sonicates of rabbit alveolar macrophages. Neuraminidase activity was maximal at pH 4.5 and 5.0, and the specific activity for sialic acid release was up to 13-fold greater with mucin than with human myelin. Activity in the growth media from cultures of pathogenic Naegleria fowleri was ion-independent, while that of macrophage sonicates required divalent cation; optimal activity was noted with 2.5 mM Zn2+, while Mg2+ and Mn2+ supported activity to a lesser extent. Such acid-active neuraminidases may contribute to the reported glycolipid alterations associated with demyelinating diseases.

Amoeba↗
PubMed1986

Sarcoplasmic reticulum dysfunction: phospholipid alterations induced by lysosomal phospholipase C.

Previous work has demonstrated that myocardial ischemia results in a breakdown of the excitation-contraction coupling system of cardiac muscle associated with lysosomal activation. It has been hypothesized that lysosomal activation during the course of myocardial ischemia is mediated by the production of oxygen free radicals. We have tested the hypothesis that myocardial ischemia results in the activation of lysosomal phospholipase C and disruption of calcium transport in sarcoplasmic reticulum (SR) mediated by oxygen free radicals. Three groups of dogs were studied: sham-operated controls (n = 6); normothermic global ischemia of 30-min duration (n = 6); and 30 min of normothermic global ischemia pretreated with intracoronary superoxide dismutase (SOD, 10 micrograms/ml) plus catalase (25 micrograms/ml). In vitro, isolated SR demonstrated a significant depression of calcium uptake rates and Ca2+-stimulated, Mg2+-dependent ATPase activity at both pH 7.0 and 6.4 with the depression at pH 6.4 greater than 7.0. This depression of SR function was significantly inhibited in hearts pretreated with SOD plus catalase. In sham-operated controls, acid-induced dysfunction was associated with substantial loss of phospholipid phosphorus and major changes in phospholipid composition. SR contained an extremely active, ion-independent sphingomyelinase-phospholipase C (SM-PLC) that had maximal activity at pH 4.5-5.0. This SM-PLC was activated when control SR was incubated at acid pH and the specific activity of SM-PLC was decreased 50% in SR isolated from normothermic global ischemia. Activity remained at control levels in hearts pretreated with SOD plus catalase.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1984

Inhibition of lysosomal phospholipases C and A in rabbit alveolar macrophages, polymorphonuclear leukocytes and rat liver by sodium bisulfite.

Phospholipase C activity was measured in disrupted rat liver lysosomes, Bacillus Calmette Guérin-induced rabbit alveolar macrophages and glycogen-induced rabbit polymorphonuclear leukocytes, using [N-methyl-14C]sphingomyelin and the phospholipids of human myelin. Phospholipase C activity with both substrates was maximal at pH 4.5 and was unaffected by monovalent or divalent cations or EDTA. The enzyme(s) had little or no substrate specificity, since most of the phospholipids of human myelin were degraded to the same extent. Solutions of gentamycin and tobramycin which contained preservatives inhibited activity, whereas similar preparations of streptomycin had no effect. On the other hand, preservative-free solutions of gentamycin and tobramycin were not inhibitory. Sodium bisulfite, an antioxidant, used in commercial preparations of gentamycin, tobramycin, streptomycin and other drugs, produced dose-dependent, reversible inhibition of the sphingomyelinase and myelin-degrading phospholipase C. Moreover, bisulfite-antibiotic interactions protected enzymatic activity from inactivation by the antioxidant. Other preservatives in commercial aminoglycosides, methyl- and propylparaben, phenol and EDTA had no effect on enzymic activity. Sodium bisulfite also inhibited acid-active phospholipase(s) A in rat liver lysosomes and alveolar macrophages, but had no effect on neutral-active, calcium-dependent phospholipases A2 from various cell types. Equimolar concentrations of streptomycin instantaneously relieved most of the inhibition by bisulfite, whereas molar ratios of gentamycin/bisulfite of 10 restored only 50% of the activity.

Animals↗