Search PubMed⌕ Search

Biomedical subjects

D D Brown

Publications and source records attributed to D D Brown.

At least 127 records · Page 7Linked to original sources
PubMed1981

Related 5S RNA transcription factors in Xenopus oocytes and somatic cells.

Xenopus oocytes contain an abundant protein that binds specifically to the center of 5S RNA genes and directs their transcription by RNA polymerase III. This protein also binds to 5S RNA. We show here that transcription of cloned 5S RNA genes in extracts derived from Xenopus tissue culture cells is dependent on the intragenic control region and is inhibited by 5S RNA and by antibodies raised against the previously characterized oocyte transcription factor. Somatic cells contain a protein that is similar to the oocyte factor in charge, affinity for heparin-agarose, and antigenicity but has an apparent molecular mass about 2000 daltons greater than that of the oocyte protein. Our experiments strongly suggest that this larger protein is the transcription factor for 5S RNA genes in somatic cells. The 5S RNA may regulate its own synthesis in somatic cells by binding to this protein, which is present at a low concentration. The presence of two different proteins responsible for 5S RNA synthesis in oocytes and in somatic cells cannot by itself explain the developmental control of oocyte and somatic 5S RNA genes, because somatic cell extracts transcribe both types of gene.

Animals↗
PubMed1980

Characterization of two xenopus somatic 5S DNAs and one minor oocyte-specific 5S DNA.

The somatic 5S DNA from X. borealis (Xbs 5S DNA) and X. laevis (Xis 5S DNA) and a minor oocyte-specific 5S DNA from X. laevis (Xit 5S DNA) have been purified, and individual repeating units have been cloned and sequenced. The two somatic 5S DNAs differ from the major oocyte 5S DNAs in having GC-rich spacers, homogeneous repeat lengths and no "pseudogenes." The somatic 5S DNAs from the two species have similar spacer sequences with differences due to single base changes and insertions/deletions. The spacer of the minor oocyte-specific 5S DNA (Xit) has the AT-rich sequence characteristic of the major oocyte 5S DNAs from X. laevis and X. borealis, and contains one duplication that has diverged approximately 40%. Like the somatic 5S DNAs, Xit 5S DNA has a homogeneous length repeat and a unique nucleotide sequence in its spacer. The presence of variable-length spacer regions in a multigene family correlates with variables numbers of a simple sequence in the spacer regions.

Animals↗
PubMed1980

A control region in the center of the 5S RNA gene directs specific initiation of transcription: I. The 5' border of the region.

The 5S ribosomal RNA gene of Xenopus contains a region within the gene that directs the initiation of 5S RNA synthesis. This result was obtained by enzymatically deleting a fragment of X. borealis somatic 5S DNA from the 5' side of the gene and cloning the resultant mutants. These deletion mutants were tested for their ability to support 5S RNA transcription in an oocyte nuclear extract. Mutants lacking the entire 5' flanking region synthesized 5S RNA or slightly smaller RNAs that were initiated a few nucleotides into the gene. Mutants deleted as far as 50 nucleotides into the gene synthesized discrete RNAs of 116--121 nucleotides. These RNAs were fused transcripts that were initiated in the plasmid vector, transcribed through the remainder of the 5S RNA gene and terminated at the end of the gene. Mutants deleted 55 or more nucleotides into the gene synthesized little or no 5S size RNA. When additional nucleotides were inserted between nucleotides +40 and +41 of the gene, discrete transcripts of approximately 120 nucleotides were synthesized that had initiated within the gene. We conclude that a control region within the gene directs RNA polymerase III to initiate transcription approximately 50 nucleotides upstream from the 5' border of this region. The 3' border of the control region resides between gene residues +80 and +83 as determined in work described in the accompanying paper (Bogenhagen, Sakonju and Brown, 1980). When this control region is present, the exact site of initiation is determined by the sequence around the start site.

Animals↗
PubMed1980

A specific transcription factor that can bind either the 5S RNA gene or 5S RNA.

5S ribosomal RNA specifically inhibits transcription of cloned repeating units of 5S DNA in a nuclear extract of Xenopus oocytes. The inhibition can be explained by the interaction of 5S RNA with a transcription factor that binds specifically to a control region located within the 5S RNA gene. This transcription factor is identical to an abundant cytoplasmic protein that is known to be complexed with 5S RNA in immature Xenopus oocytes. Thus the presence of large amounts of this protein in these cells can account for both the high rate of synthesis and the subsequent storage of 5S RNA to ribosome synthesis.

Animals↗
PubMed1980

Efficacy of traditional continuing medical education in changing physician knowledge and behavior in the care of patients with acute myocardial infarction.

In a controlled study, we assessed the effectiveness of a 2 hour traditional CME program in changing the knowledge and behavior of 23 family physicians caring for 123 patients with acute myocardial infarction. Although significant immediate gains in knowledge occurred, these gains were not translated into significant improvements on 33 patient care practices as assessed by a special medical audit instrument.

Clinical Competence↗
PubMed1979

Transcription initiation of Xenopus 5S ribosomal RNA genes in vitro.

We have studied initiation of transcription of 5S RNA genes in extracts of Xenopus laevis oocyte nuclei. To aid in this study we developed a general assay for specificity of transcription initiation that does not require accurate termination of transcription. Following in vitro transcription with gamma-32P-labeled nucleoside triphosphages, the RNA is digested with pancreatic RNAase and fingerprinted by two dimensional chromatography. A 5S RNA gene with a variant sequence, in which the G residue at position +1 is replaced by a C, initiates transcription at an A residue one nucleotide preceding the C. Although Xenopus RNA polymerase form III can initiate transcription at many sites on plasmid DNA, all of the transcripts start with purines. The majority of these purines are triphosphorylated. When a repeating unit of Xenopus 5s DNA is inserted into the plasmid, initiations at the vector start sites are suppressed and the major labeled 5' oligonucleotide is derived from 5S RNA.

Adenosine Triphosphate↗
PubMed1978

Nucleotide sequence of Xenopus borealis oocyte 5S DNA: comparison of sequences that flank several related eucaryotic genes.

Genomic Xenopus borealis oocyte-specific 5S DNA (Xbo) contains clusters of 5S rRNA genes. The number of genes varies among clusters, and the distance between genes within a cluster is about 80 nucleotides. The spacer DNA between gene clusters is AT-rich and heterogeneous in length due in part to variable numbers of a tandemly repeated 21 nucleotide sequence. A cloned fragment of Xbo 5S DNA (Xbo1) containing three 5S rRNA genes has been sequenced. The sequences of Xbo1 genes 1 and 2 are very similar to the dominant 5S RNA sequence, whereas 15 of the 120 residues in the third gene are different. The sequence of gene 3 is as different from the dominant gene sequence as the X. laevis pseudogene is from the 5S RNA gene. Sequence analysis of genomic DNA shows that gene 3 is an abundant component of the multigene family. All three genes are transcribed when added to an extract of X. laevis oocyte nuclei, and a fragment of Xbo1 lacking the AT-rich spacer DNA and the 5' end of the first gene supports transcription of genes 2 and 3 in this in vitro system. Thus the 80 nucleotides preceding each 5S gene are sufficient for promoter function. Nucleic acid sequences preceding several eucaryotic genes that are transcribed by RNA polymerase III were analyzed and the following common features were found: a purine-rich region; at least one direct repeat; the absence of dyad symmetry; transcription beginning with a purine; a pyrimidine residue immediately preceding the first nucleotide of the gene; and the oligonucleotides AAAAG, AGAAG and GAC, located approximately 15, 25 and 35 nucleotides, respectively, before the start of transcription. The 10 base pair (bp) spacing between the homologous oligonucleotides is that expected for a recognition signal on one face of a DNA double helix. The extensive sequence differences between most of the spacers that precedes these genes make the three conserved oligonucleotides more striking. Parts of the 5' flanking regions of the three Xbo1 gene (-12 to -40), which include the conserved oligonucleotides, are identical. In contrast, 7 of the first 11 nucleotides that precede the third 5S RNA gene in Xbo1 differ from those that precede the first gene. The sequences following the X. borealis oocyte and somatic 5S genes are identical in 12 of the first 14 residues and contain two or more T clusters, as does the corresponding region of X. laevis oocyte 5S DNA. The 3' sequences of the Xenopus 5S rRNA genes and several other eucaryotic genes contain features in common with procaryotic transcription termination sites. The 3' end of the gene is GC-rich and contains a dyad symmetry. Termination occurs in an AT-rich region containing one or more T clusters on the noncoding strand.

Animals↗
PubMed1978

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. I. The AT-rich spacer.

The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.

Adenine↗
PubMed1978

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. II. The GC-rich region.

The primary sequence of the GC-rich half of the repeating unit in X. laevis 5S DNA has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. The GC-rich half of the repeating unit contains a single long duplication of 174 nucleotides. The duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. The duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotides from the corresponding portion of the gene, and the remaining duplicated sequence of 73 nucleotides differs by 13 nucleotides. The plasmid-cloned repeating unit differs from the dominant sequence in the total population repeating units by 6 nucleotides in the GC-rich region. Evidence is provided that most of the CpG dinucleotides in 5S DNA are at least partially methylated.

Animals↗
PubMed1978

A nuclear extract of Xenopus laevis oocytes that accurately transcribes 5S RNA genes.

Xenopus 5S RNA genes in recombinant form with the plasmid pMB9 are transcribed accurately when added to a supernatant fraction obtained from disrupted nuclei of Xenopus laevis oocytes. After an initial 30 min lag period, the rate of synthesis of 5S RNA is constant for at least an hour and synthesis is still detected after 18 hr. As much as 40% of the total RNA synthesized from the recombinant DNA used in these experiments can be 5S RNA. The coding strand of the 5S RNA genes is transcribed at a rate 10 to 15 times greater than the noncoding strand. Plasmid and spacer DNA, however, are also transcribed. What fraction of total RNA synthesized is 5S RNA is strongly affected by DNA concentration, ionic strength and MgCl2 concentration. Inhibition of transcription by intermediate concentrations of alpha-amanitin demonstrates that RNA polymerase III transcribes at least 90% of all RNA synthesized. Adenovirus 2 DNA is also transcribed in the nuclear supernatant by RNA polymerase III. Approximately 15% of the total RNA synthesized migrates in an acrylamide gel as a band of 5.5S RNA and has been identified as virus-associated RNA1 by its oligonucleotide fingerprint.

Animals↗
PubMed1978

Cloned single repeating units of 5S DNA direct accurate transcription of 5S RNA when injected into Xenopus oocytes.

Single and multiple repeating units of three types of Xenopus 5S DNA recombined with the plasmid pMB9 serve as templates for the accurate synthesis of 5S RNA after their injection into Xenopus laevis oocyte nuclei. All 15 cloned single repeating units of X. laevis oocyte 5S DNA that were tested supported 5S RNA synthesis. Three cloned fragments of X. borealis oocyte 5S DNA and one cloned single repeating unit of X. borealis somatic 5S DNA were templates for 5S RNA synthesis. We conclude that the majority of repeating units of 5S DNA in these multigene families contain the information for accurate initiation and termination of 5S RNA synthesis. The ability of this system to detect sequence changes that affect transcription is demonstrated.

Animals↗