Search PubMed⌕ Search

Biomedical subjects

D Breviario

Publications and source records attributed to D Breviario.

At least 19 recordsLinked to original sources
PubMed2000

Overexpression of the calcium-dependent protein kinase OsCDPK2 in transgenic rice is repressed by light in leaves and disrupts seed development.

Independent transgenic rice lines overexpressing the rice CDPK isoform OsCDPK2 were generated by particle bombardment. High levels of OsCDPK2 were detected in leaves removed from etiolated plants, as well as in stems and flowers. However, there was no overexpression in green leaves that had been exposed to light, confirming that OsCDPK2 protein stability was subject to light regulation. The morphological phenotype of transgenic plants producing high levels of recombinant OsCDPK2 was normal until the onset of seed development. Flowers developed normally, producing well-shaped ovaries and stigmas, and mature anthers filled with pollen grains. However, seed formation in these plants was strongly inhibited, with only 3-7% of the flowers producing seeds. Seed development was arrested at an early stage. We discuss these data with respect to the possible requirement for specific CDPK isoforms during rice seed development.

Calcium-Binding Proteins↗
PubMed2000

Meiotic mutants of Medicago sativa show altered levels of alpha- and beta-tubulin.

We have analysed the level of accumulation of alpha- and beta-tubulin polypeptides in flowers collected from different meiotic mutants of alfalfa (Medicago sativa L.). The H33 mutant previously identified as a producer of male and female gametes with the somatic chromosome number (2n gametes) as a result of defective spindle orientation or, more rarely, abnormal cytokinesis, showed a higher level of alpha- and beta-tubulin compared to control diploid plants and approximately the same level as control tetraploid plants. A higher level of tubulin was likewise observed in diploid plants displaying abnormalities in spindle orientation and cytokinesis, which had gone through 3-4 cycles of phenotypic recurrent selection to increase 2n gamete production. A similar analysis was performed on another class of Medicago meiotic mutants characterized by production of 4n pollen (jumbo pollen, due to the absence of cytokinesis at the end of meiosis) and 2n eggs. Again, the level of alpha- and beta-tubulin was found to be higher in the mutants than in diploid controls. We conclude that meiotic defects, such as abnormal spindle orientation or cytokinesis leading to the formation of 2n gametes, determine an increased level of tubulin, the main constituent of plant microtubules (MTs).

Cell Division↗
PubMed1999

Rice calcium-dependent protein kinase isoforms OsCDPK2 and OsCDPK11 show different responses to light and different expression patterns during seed development.

We investigated the spatial and temporal expression patterns of two rice calcium-dependent protein kinases (CDPKs), OsCDPK2 and OSCDPK11, using isoform-specific antisera. Bands of the expected molecular sizes for OsCDPK2 (59 kDa) and OsCDPK11 (61 kDa) were detected on western blots. OsCDPK2 and OsCDPK11 mRNA and protein levels increased in unison during flower development. However, at the onset of seed development, the protein expression profiles diverged significantly. OsCDPK2 protein was expressed at low levels during early seed development, but increased to high levels that were maintained in later stages (20 days after fertilisation, DAF). Conversely, OsCDPK11 protein levels were high at the beginning of seed development, but fell rapidly from 10 DAF onwards. This decrease in the level of OsCDPK11 protein was associated with the abundant synthesis of a truncated mRNA species. OsCDPK2 expression was also closely associated with light perception. OsCDPK2 protein was barely detectable in green leaves exposed to light, but levels increased sharply when plants were shifted to darkness. Initially, this increase reflected a rapid elevation in the levels of OsCDPK2 mRNA, which was normally located in the mesophyll. Conversely, OsCDPK11 mRNA and protein levels were unaffected by light. These data strongly indicate that two rice CDPK isoforms have different functions in seed development and in response to light in leaves.

Blotting, Western↗
PubMed1998

In rice, Oryzalin and abscisic acid differentially affect tubulin mRNA and protein levels.

The effect of the anti-microtubular drug Oryzalin (3,5-dinitro-N4,N4-dipropylsulfanilamide) on growth and elongation of rice (Oryza sativa L. cv. Arborio) roots and coleoptiles was investigated. At 100 nM, Oryzalin strongly reduced primary root elongation, caused loss of cell anisotropy and the disappearance of the cortical microtubule array. Under these conditions the amounts of alpha- and beta-tubulin protein, but not mRNA, were heavily reduced. Similar data were also obtained in coleoptile segments treated with different concentrations of Oryzalin. However, when coleoptile elongation was inhibited by cis-abscisic acid, remarkable decreases in alpha- and beta-tubulin accumulation were observed to occur at the mRNA level but not at the protein level. The transcriptional decreases could be reversed by re-addition of 3-indole acetic acid. Altogether, these data indicate that rice tubulin accumulation can be controlled at different levels, mRNA or protein, in response to Oryzalin or abscisic acid treatments.

Abscisic Acid↗
PubMed1997

Molecular cloning of three rice alpha-tubulin isotypes: differential expression in tissues and during flower development.

We have isolated three rice cDNA sequences coding for divergent isotypes of alpha-tubulin. TubA1 and TubA2 are members of the plant subfamily I of alpha-tubulins whereas TubA3 belongs to subfamily II. The pattern of accumulation of TubA3 mRNA in rice flowers, roots and coleoptile segments treated with auxin differs significantly from what observed for TubA1 and TubA2 mRNAs.

Amino Acid Sequence↗
PubMed1995

Molecular cloning of two novel rice cDNA sequences encoding putative calcium-dependent protein kinases.

We have isolated, from a cDNA library constructed from rice coleoptiles, two sequences, OSCPK2 and OSCPK11, that encode for putative calcium-dependent protein kinase (CDPK) proteins. OSCPK2 and OSCPK11 cDNAs are related to SPK, another gene encoding a rice CDPK that is specifically expressed in developing seeds [20]. OSCPK2 and OSCPK11-predicted protein sequences are 533 and 542 amino acids (aa) long with a corresponding molecular mass of 59436 and 61079 Da respectively. Within their polypeptide chain, they all contain those conserved features that define a plant CDPK; kinase catalytic sequences are linked to a calmodulin-like regulatory domain through a junction region. The calmodulin-like regulatory domain of the predicted OSCPK2 protein contains 4 EF-hand calcium-binding sites while OSCPK11 has conserved just one canonical EF-hand motif. In addition, OSCPK2- and OSCPK11-predicted proteins contain, at their N-terminal region preceding the catalytic domain, a stretch of 80 or 74 residues highly rich in hydrophilic amino acids. Comparison of the NH2-terminal sequence of all three rice CDPKs so far identified (OSCPK2, OSCPK11 and SPK) indicates the presence of a conserved MGxxC(S/Q)xxT motif that may define a consensus signal for N-myristoylation. OSCPK2 and OSCPK11 proteins are both encoded by a single-copy gene and their polyadenylated transcripts are 2.4 and 3.5 kb long respectively. OSCPK2 and OSCPK11 mRNAs are equally abundant in rice roots and coleoptiles. A 12 h white light treatment of the coleoptiles reduces the amount of OSCPK2 mRNA with only a slight effect on the level of OSCPK11 transcript. With anoxic treatments, OSCPK2 mRNA level declined significantly and promptly while the amount of OSCPK11 transcript remained constant.

Amino Acid Sequence↗
PubMed1995

Localization of lipase genes on Candida rugosa chromosomes.

In the yeast Candida rugosa the lipase isozymes are encoded by a family of genes, five of which have been cloned and sequenced in our laboratory. In this paper we report on the identification and preliminary characterization of two new related sequences, thus extending this multigene family to seven members. The total DNA content of Candida cells was estimated by laser flow-cytometry at about 20 Mb. Eight chromosomes with sizes ranging between 100 kb and 2.1 Mb, as determined by comparison with S. cerevisiae chromosomal bands, were resolved by pulsed-field gel electrophoresis. The lipase-encoding genes were localized on chromosome I, therefore suggesting that they have originated through multiple duplication events of an ancestral gene.

Base Sequence↗
PubMed1993

Rice membranes contain a calcium-dependent protein kinase activity with biochemical features of animal protein kinase C.

The presence of calcium-dependent protein kinase activities in rice was investigated. Membrane preparations could phosphorylate the MARCKS peptide, a highly specific substrate for animal protein kinase C (PKC). Phosphorylation, strictly dependent on calcium, was specifically antagonized by a peptide whose amino acid sequence corresponds to the inhibitory, pseudosubstrate domain of mammalian PKC. Similar results have been obtained with rice soluble fractions. Addition of inhibitors of mammalian PKC (staurosporine and calphostin C) also inhibited phosphorylation of specific peptide substrates. Western blot analysis with anti-PKC antibodies identified three major bands (90, 87 and 54 kD) in rice membrane-associated proteins.

Blotting, Western↗
PubMed1993

Evolutionary conservation of genomic sequences related to the GGP1 gene encoding a yeast GPI-anchored glycoprotein.

The GGP1 gene encodes the only GPI-anchored glycoprotein (gp115) that has been purified to-date in the budding yeast Saccharomyces cerevisiae. It is a single-copy gene whose deduced amino-acid sequence shares no significant homology to any other known protein. In this paper we report a Southern hybridization analysis of genomic DNA from different eukaryotic organisms to identify homologues of the GGP1 gene. We have analyzed DNA prepared from a unicellular green alga (Chlamydomonas eugametos), from two distantly related yeast species (Candida cylindracea and Schizosaccharomyces pombe), and from the common bean Phasoleus vulgaris. The moderate stringency of the experimental conditions and the high specificity of the probes used indicate that a single-copy of GGP1-related sequences exists in all these eukaryotic organisms. The chromosomal localization of the GGP1 gene in S. cerevisiae has also been determined.

Animals↗
PubMed1992

Auxin and growth regulation of rice coleoptile segments : molecular analysis.

Auxin-stimulated elongation of apical segments of rice (Oryza sativa L. cv Arborio) coleoptiles occurring in the first 4 hours of treatment has been studied. Cell extension promoted in the first 2 hours by 10 micromolar indole-3-acetic acid (IAA) is specifically auxin-dependent, whereas after 4 hours, elongation also depends on endogenous production of ethylene. Similar to other systems, rice coleoptile cell elongation stimulated by auxin requires continuous synthesis of RNA and protein. Two-dimensional gel analysis of the in vitro translation products obtained from polyadenylated RNAs extracted from treated and untreated segments after 1 or 4 hours from the initial addition of IAA shows few transcriptional differences. At 60 minutes of treatment, the level of three mRNAs coding for proteins of 22.5, 25, and 33 kilodaltons was moderately enhanced while the disappearance of a 38 kilodalton translation product was observed. Additional repression of another mRNA coding for a 28 kilodalton product begins to show by this time, but becomes more evident after 4 hours treatment. At 4 hours, four IAA-specific mRNA enhancements coding for proteins with molecular masses ranging between 35 to 40 kilodaltons were also observed. We discuss these data in relation to the possible involvement of IAA-mediated transcriptional regulation in growth promotion of rice coleoptiles and, more widely, in control of cell elongation.

Journal Article↗
PubMed1991

Cloning and transcriptional analysis of the ADE6 gene of Saccharomyces cerevisiae.

The Saccharomyces cerevisiae gene, ADE6, encoding 5'-phosphoribosylformyl glycinamidine synthetase (EC 6.3.5.3) has been cloned by complementation of an ade6 auxotroph. Transformation of ade6 mutants with ADE6-carrying centromeric plasmids restored normal, adenine-independent growth behavior in the recipients. Strains containing a disrupted ade6 allele were constructed and behaved as stable adenine auxotrophs. Southern transfer and genetic analyses of strains carrying a disrupted ade6 allele demonstrated that the cloned gene was ADE6 and not a suppressor. The cloned ADE6 DNA was mapped on the RAD2-proximal fragment of chromosome VII by hybridization on yeast chromosomes separated by pulsed-field gel electrophoresis. Northern-blot hybridization experiments show that the ADE6 region produces two different mRNA species of approx. 5 and 2 kb. Disappearance of the larger, but not the smaller, transcript is associated with ade6 mutations. A threefold repression in the amount of the 5-kb ADE6 mRNA is observed when growth medium is supplemented with exogenous adenine.

Adenine↗
PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗
PubMed1988

Accumulation of processing intermediates of the RAS2 protein in strain 112 of Saccharomyces cerevisiae.

Strain 112 (RAS1 RAS2) contains a naturally occurring mutation which significantly retards processing of the RAS2 gene product. This mutation, resulting in the accumulation of precursor forms of RAS2 protein, has been assigned by genetic analysis to a single chromosomal locus distinct from the RAS2 locus. In addition to the known precursor molecule of 41000 daltons (p41), 112 cells accumulate within the soluble fraction an intermediate form of RAS2 (p40-1), which migrates, in SDS-polyacrylamide gel, between p41 and the fully processed, membrane-bound 40,000 daltons (p40) product. We propose for RAS2 protein processing the following sequence of events: p41 greater than p40-1 greater than p40 where p40-1 represents a RAS2 intermediate required for the targeting of the protein to the plasma membrane.

Electrophoresis, Polyacrylamide Gel↗
PubMed1988

Multiple regulatory mechanisms control the expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae.

Expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae has been examined at the transcriptional and translational levels. When dextrose is the carbon source, the steady-state amount of RAS1 mRNA and the rate of RAS1 protein synthesis are reduced in parallel as cells approach the mid-exponential phase of growth. RAS1 mRNA levels and protein synthesis are very low at all stages of growth when ethanol rather than dextrose is provided as the sole carbon source. The rate of RAS2 protein synthesis is regulated differently. In cells cultured on dextrose, it is lowest in the early exponential phase, increases approximately 10-fold and remains nearly constant as cells approach stationary phase. By contrast, RAS2 mRNA is found at uniformly high levels at all phases of exponential growth, suggesting that the translational efficiency of RAS2 mRNA is repressed during the early exponential phase. This repression is not observed when ethanol is the sole carbon source. Nutrient starvation, resulting in G1 arrest and sporulation in diploids, leads to greatly decreased amounts of RAS2 mRNA, accomplished in part by selective repression of RAS2 transcripts with particular 5' ends. However, this reduction in RAS2 mRNA levels has little effect on the rate of RAS2 protein synthesis, suggesting that the translational efficiency of RAS2 mRNA is stimulated by nutrient starvation. The combination of transcriptional and translational controls which regulate yeast RAS gene expression seems to ensure that one or the other RAS proteins will be produced over a wide range of physiological states.

Cell Cycle↗
PubMed1986

Carbon source regulation of RAS1 expression in Saccharomyces cerevisiae and the phenotypes of ras2- cells.

Transcriptional analysis of the yeast RAS genes in different culture conditions suggests that the inability of ras2 mutants to grow in nonfermentable carbon sources results from the regulation of RAS1 mRNA expression. The amount of RAS1 mRNA is significantly repressed in cultures grown on the nonfermentable carbon sources ethanol and acetate. As a result, low RAS function should be expressed under these conditions in a ras2 mutant. This can explain the inability of ras2- cells to grow on nonfermentable carbon sources. This interpretation is supported by the finding that an extragenic suppressor of ras2- (sra6-15), which restores growth on ethanol or acetate, also leads to an increase in the amount of RAS1 mRNA under these conditions. The sra6-15 mutation does not alter the level of RAS1 mRNA in cells grown on glucose. The pattern of transcriptional regulation described for the RAS1 gene is not shared by RAS2, indicating differential control of the functionally homologous yeast RAS genes at the level of gene expression.

Carbon↗