Charge-exchange and helicity-flip scattering in the field of a 't Hooft-Polyakov monopole.
Explore the source record for details and available documents.
Journal Article↗
Biomedical subjects
C Schmid
Publications and source records attributed to C Schmid.
[Immunohistochemical studies in the differential diagnosis of malignant fibrous histiocytoma].
Malignant fibrous histiocytomas (MFH) belong to the most frequent soft tissue tumours in adults and have to be discriminated from other tumours with similar morphology. Various tumour markers aid the differential diagnosis. Twenty cases of MFH were studied immunohistochemically using antibodies to vimentin, TPA, desmin, lysozyme, alpha 1-antitrypsin, alpha 1-antichymotrypsin, S-100 protein, neurone-specific enolase (NSE), laminin, fibronectin and ferritin. Vimentin and lysozyme were found in the tumour cells of all, alpha 1-antitrypsin of 18, alpha 1-antichymotrypsin of 19, fibronectin of 16 and ferritin of 12 cases. Antibodies of TPA, desmin, S-100 protein, NSE and laminin did not reveal positive immunoreactivity. Exclusion of spindle-cell carcinoma can be made by positive vimentin and negative TPA reactivity, of melanoma by negative S-100 reactivity, and of leio- and rhabdomyosarcoma by lack of desmin immunoreactivity. Schwannomas contain S-100 protein, but lack lysozyme, alpha 1-antitrypsin, alpha 1-antichymotrypsin and fibronectin. Pleomorphic liposarcomas cannot be distinguished from MFH on the basis of immunohistochemical staining. Vimentin, alpha 1-antitrypsin, alpha 1-antichymotrypsin and fibronectin can, therefore, be regarded as useful markers in the differential diagnosis of MFH.
Adult↗
Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac.
A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X + 3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.
Animals↗
Ultrastructural alterations and virus-like particles in lymph nodes of drug addicts with lymphadenopathy syndrome (LAS).
Lymph node biopsies from 16 cases of intravenous drug addicts with lymphadenopathy syndrome (LAS) have been examined at the electron microscope. The main ultrastructural alterations observed in the lymphocytes, dendritic reticulum cells and endothelial cells were tubulo-reticular structures (TRS), test tube and ring shaped forms (TRF) and nuclear pockets (NP). Images suggesting virus budding from lymphocytes and virus-like particles have also been found in 9 out of the 16 cases. The possibility to correlate the latter findings with a better knowledge of LAS evolution and prognosis is discussed.
AIDS-Related Complex↗
Triiodothyronine increases responsiveness of cultured rat bone cells to parathyroid hormone.
Osteoblast-like cells prepared from calvaria of newborn rats and grown in culture for 1 week show markedly increased ornithine decarboxylase (ODC) activity upon exposure to parathyroid hormone (PTH) for 4 h. Triiodothyronine (T3) increases ODC activity of the cultures in long-term experiments but does not stimulate cell replication. Moreover, PTH responsiveness is enhanced by T3. Thus, T3 acts directly on bone cells, and the clinical observation of bone sensitization to PTH by thyroid hormones is confirmed at the cellular level.
Animals↗
Actions of insulin-like growth factors.
Explore the source record for details and available documents.
Animals↗
Effects of insulin-like growth factors on chick embryo hepatocytes.
Biological effects of insulin-like growth factors (IGF) I and II on primary cultures of chick embryo liver cells have been investigated and compared 1) with the biological effect of insulin and 2) with competitive binding of the three hormones to their respective binding sites. IGF I and II stimulate the incorporation of D[U-14C]-glucose into liver cell glycogen in a time- and dose-dependent manner, but with a 5-10-fold lower potency than insulin. Both IGFs also lead to enhanced incorporation of 5-[3H]uridine and L[U-14C]valine into trichloroacetic acid (TCA) insoluble material and to activation of ornithine decarboxylase activity. Their potency in stimulating RNA synthesis and ornithine decarboxylase activity is comparable to that of insulin. Protein synthesis is maximally stimulated at 3 nM by all three hormones. In the competitive binding studies, IGF I and II are 10-fold less potent than insulin in competing for [125I]insulin binding, but 100-fold more potent than insulin in competing for [125I]IGF I or II binding. These studies show that IGF I and II stimulate the same metabolic indices as insulin in the chick embryo liver. By comparing these biological effects with competitive binding data it appears that IGFs act on glucose metabolism in the chick embryo liver via the insulin receptor, whereas stimulation of growth indices by IGFs and insulin appears to be mediated by their own specific receptors.
Animals↗
[External post-infarction rupture of the heart. Retrospective anatomo-clinical analysis of 70 cases].
A retrospective comparison was made between the clinical and pathological findings pertaining to: a) 70 cases of rupture of the ventricular free wall following myocardial infarction (RC group), b) 70 cases of acute myocardial infarction (AMI) where death intervened in the absence of cardiac rupture (NR group) and c) 70 cases (clinical findings only) of patients with AMI admitted to the hospital (IM group). The history of the RC group disclosed a considerably lower percentage of previous myocardial infarctions (p less than 0,005) as compared to the control groups. In the same group systemic hypertension after myocardial infarction was more frequent (p less than 0,025) than in the others. Shock, heart failure, bundle branch blocks were significantly less common in the RC group than in the NR group, and severe arrhythmias were found in a significantly lower percentage than in both the control groups. An electrocardiographic pattern of anterior AMI was more frequent in the RC group than in the IM group (p less than 0,05). Death was preceded by sudden loss of consciousness in 83% of the RC cases and in 51% of the NR cases (p less than 0,005), by severe chest pain respectively in 19% and 9% of the two groups (p less than 0,05). More than 25% of the patients of both RC and NR groups died within the first 24 hours, almost half within the third day after the onset of AMI. On autopsy the AMI was anterior and/or lateral in 77% of the cases in the RC group and in 44% of the NR group (p less than 0,005). In all the cases except one rupture had occurred in the area of the infarction. The site of rupture was anterior in 64% of the cases, posterior in 16%, lateral in 11%, and apical in 9%. Scars larger than 5 mm were noted in 17% of the cases in the RC group as compared to 37% in the NR group (p less than 0,01). Left ventricular hypertrophy was present in 16% of the RC cases and in 31% of the NR group (p less than 0,05). Finally the characteristics of patients at risk of cardiac rupture following myocardial infarction seem to be: absence of previous infarctions, anterior localization of AMI, sustained hypertension after myocardial infarction, absence of serious hemodynamic and arrhythmic complications.
Adult↗
Insulin-like growth factor I supports differentiation of cultured osteoblast-like cells.
Rat calvaria cells grown in culture for one week had properties of osteoblasts: a high content in alkaline phosphatase and a marked cyclic AMP response to parathyroid hormone (PTH). In short-term experiments, insulin-like growth factor I (IGF I) stimulated the incorporation of [14C] glucose into glycogen. When IGF I was present in the medium during 6 days the cell number increased slightly and there was a substantial, disproportionate rise in alkaline phosphatase activity of the cultures. Thus, IGF I stimulates growth, and in addition, and in contrast to other growth factors, mainly enhances differentiation of osteoblasts.
Alkaline Phosphatase↗
Biological and immunological properties of insulin-like growth factors (IGF) I and II.
Explore the source record for details and available documents.
Adipose Tissue↗
Lung calcification in long-term dialysed patients: a light and electronmicroscopic study.
Lung calcification was detected in four out of 29 long-term dialysed patients on whom postmortem examinations were performed between 1967 and 1980. On light microscopy, calcification showed either a finely granular and linear localization along the alveolar septa, or a coarse and widespread parenchymal distribution. Histochemical studies revealed evidence of calcium, magnesium and phosphate ions in the deposits. Ultrastructural examination of the less severely involved alveolar septa showed selective deposition of calcium salts within an increased amount of elastin. The deposits consisted of electron dense roundish granules with a concentric laminar structure. They appeared either single or conglomerated in polycyclic formations, supposedly representing the progressive steps of the mineralization process, at first localized within elastin and progressively spreading outside it. The high magnesium content of the deposits suggests that the serum concentration of this ion may play an important role in visceral calcification of long-term dialysed patients.
Adult↗
Intergenic DNA sequences flanking the pseudo alpha globin genes of human and chimpanzee.
We have determined the sequence of 2400 base pairs upstream from the human pseudo alpha globin (psi alpha) gene, and for comparison, 1100 base pairs of DNA within and upstream from the chimpanzee psi alpha gene. The region upstream from the promoter of the psi alpha gene shows no significant homology to the intergenic regions of the adult alpha 2 and alpha 1 globin genes. The chimpanzee gene has a coding defect in common with the human psi alpha gene, showing that the product of this gene, if any, was inactivated before the divergence of human and chimpanzee. However the chimpanzee gene contains a normal ATG initiation codon in contrast to the human gene which has GTG as the initiation codon. The psi alpha genes of both human and chimpanzee are flanked by the same Alu family member. The structure and position of this repeat have not been altered since the divergence of human and chimpanzee, and it is at least as well conserved as its immediate flanking sequence. Comparing human and chimpanzee, the 300 bp Alu repeat has accumulated only two base substitutions and one length mutation; the adjacent 300 bp flanking region has accumulated five base substitutions and twelve length mutations.
Animals↗
Preferential enhancement of myoblast differentiation by insulin-like growth factors (IGF I and IGF II) in primary cultures of chicken embryonic cells.
Cells prepared from the body walls of chicken embryos were plated in the absence of serum. Insulin-like growth factors (IGFs) barely stimulated cell replication, but preferentially enhanced the differentiation of muscle cells. Myoblast fusion was favoured in the presence of IGF (or insulin). Concomitantly, acetylcholinesterase activity increased. IGF I and IGF II were equipotent and active in low physiological concentrations, in contrast to insulin, which was known for a long time to exert such effects at pharmacological concentrations.
Acetylcholine↗
Insulin-like growth factors stimulate synthesis of nucleic acids and glycogen in cultured calvaria cells.
A (sub)population of cells obtained from newborn rat calvaria by (sequential) collagenase digestion is grown to confluence in serum-containing medium. These cells are osteoblast-like with respect to high alkaline phosphatase activity and marked responsiveness (cAMP) to parathormone. Insulin-like growth factors (IGFs) enhance net incorporation of the labeled precursors thymidine, uridine, and glucose into the respective macromolecules DNA, RNA, and glycogen. Human IGF I is five times as potent as IGF II in evoking these anabolic responses in cultured rat calvaria cells. In contrast to insulin, the factors are effective in concentrations in which they are present in serum.
Alkaline Phosphatase↗
Molecular evolution of the human adult alpha-globin-like gene region: insertion and deletion of Alu family repeats and non-Alu DNA sequences.
Previous heteroduplex studies have revealed extensive sequence homology between the two human adult alpha-globin-like genes (alpha 2 and alpha 1) and their flanking regions. These homologous regions, which are interrupted by two blocks of nonhomology, each span approximately 4 kilobases [Lauer, J., Shen, C.-K. J. & Maniatis, T. (1980) Cell 20, 119-130]. We have determined 3 kilobases of DNA sequences within and flanking the nonhomologous blocks of these two tandem duplication units. A total of three Alu family repeats has been identified. Two of them are approximately 300 base pairs long and define the 3' ends of the first homology blocks. The third Alu family member is a 600-base-pair-long sequence consisting of two monomeric Alu members arranged in a head-to-tail fashion. It is located in the 3' portion of the first block of nonhomology in alpha 2-gene-containing unit. We present direct evidence that this dimeric Alu sequence was inserted at a staggered break. The second nonhomology block is the result of insertion or deletion of a 224-base-pair sequence. From these data and the calculation of sequence divergence, we propose a history for the evolution of the human adult alpha-globin-like gene region. We also suggest that DNA insertion elements may disrupt gene correction processes in the two duplication units containing alpha 2- and alpha 1-globin genes.
Adult↗
Parathormone promotes glycogen formation from [14C]glucose in cultured osteoblast-like cells.
Parathyroid hormone stimulates [U-14C]glucose incorporation into glycogen of cultured osteoblast-like calvaria cells. This effect is detectable only several hours after the addition of PTH and it is mimicked by dibutyryl cyclic AMP. In contrast to insulin (in pharmacological concentrations), PTH enhances glycogen formation only in calvaria cells, but not in fibroblasts. Insulin-like growth factor I in physiological concentrations promotes glycogen-synthesis shortly after addition.
Animals↗
Elastofibroma. Case report.
A case of subscapular elastofibroma in a 61-year-old male was studied by light and electron microscopy. Sixty-two cases of this lesion have been to date reported. At light microscopy, the mass was unencapsulated and consisted of dense collagen bundles with many thick elastinophilic fibers and globules. The ultrastructural examination showed the fibers contained a clear core of mature elastic tissue surrounded by a more electron-dense fibrillar material, which was attributed to newly formed elastin. After elastase digestion, the fibers failed to stain with orcein. The cells were very scanty and identified as fibroblasts. The hypothesis formulated by various authors about the nature of elastinophilic fibers and about the pathogenesis of elastofibroma are reviewed. Our findings seems to support those of most authors, who consider the lesion an abnormally increased reactive production of elastic tissue by fibroblasts in response to a mechanical stimulus.
Fibroma↗