Biomedical subjects
Publications and source records attributed to C R Newton.
By sequence analysis of the complete protein-coding region of the human alpha-1-antitrypsin gene using polymerase chain reaction techniques, we have characterised one of the normal variants, M3. We have identified a single point mutation between M1 Val213 and M3 at codon position 376 which is a GAA(Glu) to GAC(Asp) transversion.
The present study was conducted to assess the immediate psychological impact of failed in vitro fertilization (IVF). Emotional status and marital functioning were also examined pre-IVF, and both demographic information and psychological test scores were evaluated as predictors of reaction to treatment failure. After a failed first cycle, both males and females showed significant increases in anxiety and depressive symptoms. Although group means were not clinically elevated and most participants were coping adequately, the prevalence of both mild and moderate depression increased substantially, particularly among women. In addition, women without children were a subgroup particularly vulnerable to the stress of failure. Predisposition towards anxiety, pre-IVF depressive symptoms, and fertility history were the most important predictors of emotional response. Treatment implications of these findings were discussed.
We have improved the "polymerase chain reaction" (PCR) to permit rapid analysis of any known mutation in genomic DNA. We demonstrate a system, ARMS (Amplification Refractory Mutation System), that allows genotyping solely by inspection of reaction mixtures after agarose gel electrophoresis. The system is simple, reliable and non-isotopic. It will clearly distinguish heterozygotes at a locus from homozygotes for either allele. The system requires neither restriction enzyme digestion, allele-specific oligonucleotides as conventionally applied, nor the sequence analysis of PCR products. The basis of the invention is that unexpectedly, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. We have analysed DNA from patients with alpha 1-antitrypsin (AAT) deficiency, from carriers of the disease and from normal individuals. Our findings are in complete agreement with allele assignments derived by direct sequencing of PCR products.
Three mutations causing alpha-1-antitrypsin deficiency have been identified by gene amplification and direct DNA sequencing. In the Pi (proteinase-inhibitor) nullcardiff gene, the codon for aspartate at position 256 has mutated to encode valine. In PiMmalton and Pi I, the respective mutations are the deletion of the codon for a phenylalanine residue at position 51 or 52, and a single base substitution resulting in arginine being replaced by cysteine at position 39. Examination of the protein tertiary structure suggests that all of these mutations are likely to result in folding abnormalities that may explain the deficiency states.
Prenatal diagnosis of alpha 1-antitrypsin (AAT) deficiency can be performed in the 1st trimester of pregnancy. These diagnoses have been based on DNA technology using either RFLP analysis or hybridization with allele specific oligonucleotides. Several RFLPs within and flanking the AAT gene have been found to render most families informative. The polymerase chain reaction allows specific DNA sequences to be amplified up to ten million fold. Both sequences containing a specific mutation or an RFLP can be amplified by this method. We have compared conventional RFLP methods with PCR used in combination with allele specific oligonucleotides or RFLP analysis, in a case of prenatal diagnosis of AAT deficiency of the ZZ type.
We have compared sequencing of cloned "polymerase chain reaction" (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with alpha 1-antitrypsin (AAT) deficiency. In families where paternity was in question we confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. We demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, we demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. We have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.
A gene was chemically synthesised and expressed in Escherichia coli to produce [Ala30,32,33]IFN-alpha 2, an analogue of human alpha 2-interferon (IFN-alpha 2) which is devoid of activity on human cells. Eight additional analogues provided single changes in IFN-alpha 2 at each of these three conserved positions. No one residue is essential for activity, but both antiviral and anti-proliferative activity are particularly sensitive to changes in the side-chain of Arg33.
The effectiveness of 5 different solutions on the absorption of fluid and electrolytes was tested in 7 patients with a proximal intestinal stoma and large fluid losses, all of whom previously needed intravenous infusions to maintain balance. In 4 patients it proved possible to replace the intravenous infusions with an enteral supplement. The WHO glucose/electrolyte solution without added potassium (NaCl 3.5 g, NaHCO3 2.5 g, glucose 20 g/l) gave satisfactory results, though was slightly less effective than a solution containing more sodium in which maltose was substituted for glucose. Neither sucrose nor an oligosaccharide (Caloreen) gave an advantage over glucose in the formulations used. In 3 patients losses were so great, and absorption of sodium from oral solutions so small, that intravenous supplements had to be continued. These 3 patients could be distinguished from the other 4 by the fact that more than 250 ml emerged from the stoma during the 3 hours after a drink of 500 ml of glucose/electrolyte solution. In all patients a drink of water or tea led to a loss of sodium from the stoma; water should be restricted in such patients and replaced by a glucose/electrolyte solution.
One hundred and fifty-eight epileptic patients belonging to the Nguni tribe in Transkei were interviewed and examined; electro- encephalograms (EEGs) were recorded in 104. Partial epilepsy with secondary generalized seizures was diagnosed in 59%. Head trauma appeared to be the main aetiological factor in 18%. Thirty-five percent of the EEGs taken showed epileptiform activity. The community's attitude to the disease is described.
The superiority of buffer systems containing formamide for the ion-exchange high-performance liquid chromatographic separation of oligodeoxyribonucleotide mixtures generated in solid-phase syntheses is illustrated. The resolutions achieved are compared to those achieved with the same mixtures in other eluting solvents. The use of formamide systems is recommended for oligodeoxyribonucleotide purification in general and is particularly valuable where the oligonucleotide of interest is highly self-complementary and/or rich in deoxyguanosine residues.
An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system.
In an attempt to improve the antiviral efficacy of 5'-amino-2',5'-dideoxy-5-iodouridine (AIdU) the N-acetyl and N,3'-O-diacetyl derivatives were prepared. N-Acetylation of AIdU increased its ability to inhibit the phosphorylation of thymidine by the deoxypyrimidine kinase of herpes simplex virus type 1 (HSV1) while diacetylation had the converse effect. The affinity of the corresponding compounds containing uracil or thymine for virus deoxypyrimidine kinase was also determined. A range of N-acyl-, N-sulphonyl- and N,3'-O-diacyl- derivatives of AIdU were synthesized; enhanced inhibition of deoxypyrimidine kinase by a number of these compounds was observed. The previous observation that 5'-azido-2',5'-dideoxy-5-iodouridine has antiherpetic activity in vivo led us to investigate its 3'-O-acetyl derivative as well as the corresponding compound containing uracil. None of the derivatives described showed antiviral activity in cell culture against HSV1; acylation failed to enhance the potency of AIdU against HSV1 in vivo.
Explore the source record for details and available documents.
A 514-base pair fragment of double-stranded DNA coding for human interferon-alpha 1 (166 amino acid residues), and containing initiation and termination signals plus appropriate restriction enzyme sites for plasmid insertion, has been totally synthesized. The synthesis involved preparation of 66 oligodeoxyribonucleotides, ranging in size from 14 to 21 residues, plus 1 deoxydecanucleotide, by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. After ligation of the synthetic gene to a plasmid vector and transformation of Escherichia coli, clones containing the anticipated gene sequence were obtained.
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.
A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.
The effect on ileostomy function of codeine phosphate, Lomotil, or Isogel was tested in 20 subjects at home living a normal life, studied over two three-day periods on and off treatment. Codeine phosphate 60 mg three times daily was associated with a reduction in the mean total weight of ileostomy output and the ileostomy outputs of water, sodium, and potassium (p < 0.05). The proportion of faecal solids increased on codeine and the effluent appeared thicker but the output of faecal solids remained unchanged. Mean faecal fat increased on codeine. The transit rate from mouth to stoma was slower in four of the five subjects on codeine and a further two subjects withdrew from the trial with temporary intestinal obstruction while on the drug. Lomotil two tablets three times daily was associated with a small and statistically not quite significant fall in the mean total weight of ileostomy output and the ileostomy output of water. Sodium and potassium outputs in the effluent fell on Lomotil (p < 0.05) but the other parameters remained unchanged. Isogel 15 ml three times daily was associated with an increase in the mean total weight of ileostomy output and the ileostomy outputs of water, sodium, potassium, and faecal solids (p < 0.01). Although the effluent looked more viscid on Isogel, the proportion of faecal solids was unchanged. These results suggest that codeine phosphate has a beneficial effect on ileostomy function, reducing the loss of water and electrolytes, while Lomotil has a similar but less effective action in the dosage tested. By contrast, Isogel increases the ileostomy loss of water and electrolytes and will aggravate their depletion in patients with excessive fluid effluents. The increase in faecal fat associated with taking codeine phosphate suggests that it should be stopped before collecting specimens for faecal fat estimations.
Bowel habit has been studied in a group of 92 outpatients with ileorectal anastomosis for ulcerative colitis and compared with that in a group of 45 outpatients with ileorectal anastomosis for colonic polyposis. Bowel frequency ranged from 1-7 to 8-7 stools per 24 hours with a mean of 4-5 in the colitic group compared with a range of 1-3 to 8-1 stools per 24 hours and a mean of 3-5 in the polyposis group. Eighty-two per cent of the colitic group and 95% of the polyposis group had six or fewer bowel actions per 24 hours. Colitic patients in poor general condition at the time of colectomy seemed more likely to have over six bowel actions per 24 hours than those less severely ill. Urgency of defaecation was rare. Bowel actions every night and occasional faecal incontinence occurred in small but similar percentages of patients in both groups. Fifty-one per cent of patients in the colitic group, as compared with 9% in the polyposis group, were taking regular treatment to improve bowel function. Dietary difficulty was rare after ileorectal anastomosis in both colitic and polyposis groups.