Search PubMed⌕ Search

Biomedical subjects

C N Chen

Publications and source records attributed to C N Chen.

At least 55 records · Page 3Linked to original sources
PubMed1993

The Shatin community mental health survey in Hong Kong. II. Major findings.

A large-scale community survey in Shatin, Hong Kong, is presented with a modified two-phase design using flagged and nonflagged subsamples. A modified Self-Reporting Questionnaire and the Diagnostic Interview Schedule (version III) were used as the screening and diagnostic instruments, respectively. Lifetime rates for 19 Diagnostic Interview Schedule/DSM-III diagnoses are presented. The most common diagnoses in Shatin were tobacco dependence, generalized anxiety disorder, alcohol abuse and/or dependence, all phobias, and dysthymic disorder. The male-predominant disorders were tobacco dependence, alcohol abuse/dependence, pathological gambling, and antisocial personality. The female-predominant disorders were generalized anxiety disorder, all phobias, dysthymic disorder, major depressive disorder, obsessive-compulsive disorder, and bereavement.

Adolescent↗
PubMed1993

The visualization of RF probe electric fields.

An assembly of resistive paper and liquid crystal sheet, conveniently and cheaply constructed for visual detection of the electric fields associated with an rf probe, is presented. Electrical asymmetries, and "hot-spots" usually associated with conservative electric fields, are easily visualized by the color patterns displayed. The device is of considerable assistance in probe design and the minimization of dielectric loss.

Color↗
PubMed1993

Comparison of P6 acupoint injection with 50% glucose in water and intravenous droperidol for prevention of vomiting after gynecological laparoscopy.

Postoperative vomiting causes patients distress and delays discharge after outpatient surgery. Although P6 electroacupuncture is recognized as having an antiemetic effect, its inconvenient instrumentation may limit its clinical applicability. The purpose of this study was to explore a simple and effective alternative method for control of postoperative vomiting in outpatient surgery. We prospectively compared the effect of P6 acupoint injection with 0.2 ml 50% glucose in water (G/W) and intravenous injection of 20 micrograms/kg droperidol for prevention of vomiting in 120 consecutive outpatients undergoing gynecological laparoscopy with general anesthesia. Patients were randomly allocated to receive P6 acupoint injection, i.v. droperidol, or nothing as control group. Both P6 acupoint injection and i.v. droperidol 20 micrograms/kg were found to have a significant antiemetic effect when compared with the control group. We conclude that P6 acupoint injection with 50% G/W is a simple and effective method for reducing the incidence of postoperative emesis in outpatient surgery.

Acupuncture Points↗
PubMed1993

Evaluation of the Chinese version of the Hospital Anxiety and Depression Scale. A cross-cultural perspective.

The authenticity of the Chinese translation of the Hospital Anxiety and Depression Scale (HAD) was tested in a sample of medical students. The Chinese version demonstrated good agreement with the English original. There was a large difference between the mean anxiety and depression subscores. Factor analysis consistently yielded three factors, suggesting the existence of a somatic factor. It is suggested that a common cut-off point for the subscales of the HAD scale is not advisable and a multidimensional model for mood disorders is more appropriate in a cross-cultural context.

Adult↗
PubMed1993

Liver resection for hepatic metastasis from colorectal carcinoma.

One hundred and eighteen patients who suffered from metastatic liver tumors from colorectal carcinoma during the period from January 1980 to June 1991 at the National Taiwan University Hospital were retrospectively reviewed. The modes of treatment included hepatic resection (n = 18), transarterial embolization (TAE, n = 17), chemotherapy only (C/T, n = 36), and no treatment (n = 47). In the 18 patients who underwent hepatic resection during the last 10 years, the types of surgery included: wedge resection (n = 8), segmentectomy (n = 2), right hepatic lobectomy (n = 5), left hepatic lobectomy (n = 2) and extended right hepatic lobectomy (n = 1). There were no operative mortalities in this series. The overall three-year actuarial survival rate of the resection group was 57.5%. It was better than that of the TAG group (17%, p < 0.05). For a solitary tumor, the three-year actuarial survival rate rose to 64% in the resection group. There were no three-year survivors in the nonsurgical solitary tumor group. This experience defends aggressive surgical treatment of resectable hepatic metastatic liver cancer from colorectal carcinoma as a safe procedure which is able to prolong a patient's life.

Adult↗
PubMed1992

Folate concentration in Chinese psychiatric outpatients on long-term lithium treatment.

Among 46 Chinese and mostly manic-depressive (85%) outpatients attending a lithium clinic in Hong Kong, virtually no patients had low serum (0%) or erythrocyte (2%) folate. Their mean folate levels did not differ from lithium-free outpatients. Although serum folate correlated negatively with lithium dose (P less than 0.002) and serum level (P less than 0.01), lithium treatment probably did not by itself cause low folate. Folate level was not related to diagnosis, duration of mental illness, other drug usage or spot affective morbidity. Patients with a good response to lithium in the previous one year had a higher mean serum folate level than those with unsatisfactory response (P less than 0.05). These data suggest that folate deficiency is uncommon among Chinese psychiatric outpatients, but support recent evidence that folate at high concentrations enhances lithium prophylaxis.

Ambulatory Care↗
PubMed1992

Huntington's disease in Chinese: a hypothesis of its origin.

The period prevalence (1984-91) of Huntington's disease (HD) in Hong Kong Chinese was 3.7 per million population. HD patients in Mainland China and Hong Kong showed similar hereditary pattern, clinical and pathological features as in the West. Chinese HD patients were male predominant with a younger age of onset and death. Their ancestral origin could be traced mostly to the coastal provinces of China. It is proposed that Chinese HD patients may have a European origin and share the same gene pool as their white counterparts.

China↗
PubMed1991

Characterization of the memory gene dunce of Drosophila melanogaster.

The dunce (dnc) gene of Drosophila melanogaster encodes cAMP phosphodiesterase (PDEase) and is required for learning/memory and female fertility. The gene is structurally complex, demonstrated in part by Northern blotting experiments which detected multiple RNAs ranging in size from 4.2 to 9.6 kb (1 kb = 10(3) bases or base-pairs). To characterize these RNAs and to understand their sequence heterogeneity, we isolated and analyzed 29 new and independent cDNA clones representing the dnc RNAs. Restriction mapping, hybridization analysis and sequence determination of these cDNA clones and the corresponding genomic exons resolved these into six different classes. Exons defined by the cDNA clones are distributed over more than 148 kb of genomic DNA, with some exons being used alternatively among the RNAs. The RNAs are transcribed from at least three initiation sites: two of these were mapped by parallel S1-nuclease and primer extension experiments. In addition, some of the heterogeneity is generated by using varying lengths of a 3'-untranslated trailer sequence. Altogether, the results indicate that the size and sequence heterogeneity of dnc transcripts results from transcription initiation at multiple sites, alternative splicing, and processes which generate different 3' ends. The existence of multiple protein products is suggested by the alternative use of exons which code for portions of the open reading frame. The protein variation potentially includes N-terminal differences coded for by transcript-specific 5' exons and internal differences arising from the optional inclusion of a 39 base-pair exon and from the alternative use of two 3' splice sites separated by six base-pairs. Expression of a cDNA clone in yeast containing a large portion of the open reading frame produced cAMP PDEase activity identical in properties to the Drosophila enzyme affected by the dnc mutation. The results suggest that the remarkable structural complexity of dnc may reflect an intricate control of the spatial and/or temporal expression of various isoforms of cAMP PDEase.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMed1991

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities.

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1991

Noninvasive temperature imaging using diffusion MRI.

Efficacy and safety considerations for cancer therapy with hyperthermia require accurate temperature measurements throughout the heated volume. We report the use of molecular diffusion, whose temperature dependence is well known. A dedicated hyperthermia applicator was built, combining a MRI gradient coil and a rf coil. Diffusion and derived temperature images were obtained with a 1 x 2 mm pixel size on a polyacrylamide gel phantom using a clinical 1.5-T whole body MRI system. Temperatures determined from these images using 1 cm2 regions of interest were found to be within 0.2 degrees C of those recorded from the thermocouples and fiber-optic probes placed inside the gel.

Body Temperature↗
PubMed1991

Acne as a risk factor for anorexia nervosa in Chinese.

Acne is a highly visible and common skin disorder which is potentially disfiguring and associated with adverse emotional responses in adolescents, who are markedly sensitive to body image changes. Two psychologically vulnerable Chinese girls are reported, in whom traditional health concepts reinforced dieting behaviour, led to weight loss, regression of acne and eventually anorexia nervosa. The intricate interactions of acne, health beliefs, dieting behaviour and eating disorders are discussed.

Achievement↗
PubMed1990

Sleep apnoea presenting as severe hypertension and silent occipital haemorrhage.

A 39-year old Chinese man presented with an acute onset of severe headache, accelerated hypertension and subsequently an unexpected extensive right occipital haemorrhage. These were found to be related to a sleep apnoea syndrome which had been unrecognized for many years despite its typical symptoms of loud snoring and excessive daytime sleepiness. Weight reduction led to significant clinical but not polysomnographic improvement of the sleep apnoea syndrome.

Adult↗
PubMed1990

Narcolepsy in a young Chinese child.

Narcolepsy is characterized by narcoleptic sleep attacks, cataplexy, sleep paralysis and hypnagogic hallucinations. It is very rare in children. A 7-year old Chinese boy presenting with typical narcoleptic symptoms is reported. Diagnosis of narcolepsy usually relies on the clinical picture, the presence of sleep-onset REM periods on nocturnal polysomnograph and the Multiple Sleep Latency Test. The strong association with HLA-DR2 may help in diagnosis, especially in children.

Child↗
PubMed1990

Sleep apnoea syndrome--a study of 5 cases.

Sleep apnoea syndrome (SAS) is common in the West but its prevalence is uncertain in Southeast Asia. Five Chinese patients seen in a Sleep Assessment Unit in Hong Kong are presented to illustrate the spectrum of clinical features and treatment methods involved in obstructive and central sleep apnoea. The first patient is a 45-year old woman with severe obstructive SAS and cardiopulmonary complications who improved significantly after tracheostomy. The second patient is a 43-year old man who improved with weight reduction and protriptyline. The third is a 42-year old man whose SAS did not improve with uvulopalatopharyngoplasty but with continuous positive airway pressure (CPAP). The fourth is a 12-year old girl with obstructive SAS who improved significantly after tonsillectomy. The last patient is a 52-year old man with central SAS who improved with CPAP.

Child↗
PubMed1989

Anorexia nervosa in Hong Kong. Why not more in Chinese?

Anorexia nervosa is a geographically distinct psychiatric disorder; it is rapidly increasing in incidence in Western countries, while being virtually unreported in China, or in the Chinese community of Hong Kong. This is surprising when the Chinese preoccupation with food and their reported readiness to somatise dysphoria are considered. Three Chinese anorectics born and living in Hong Kong and exhibiting mostly typical clinical features are reported. The rarity of the disorder in the East could be related to protective biological and socio-cultural factors specific to the Chinese, and while it may become more common, anorexia nervosa is unlikely to reach Western proportions.

Adolescent↗