Search PubMed⌕ Search

Biomedical subjects

C N Chen

Publications and source records attributed to C N Chen.

At least 19 recordsLinked to original sources
PubMed1992

Folate concentration in Chinese psychiatric outpatients on long-term lithium treatment.

Among 46 Chinese and mostly manic-depressive (85%) outpatients attending a lithium clinic in Hong Kong, virtually no patients had low serum (0%) or erythrocyte (2%) folate. Their mean folate levels did not differ from lithium-free outpatients. Although serum folate correlated negatively with lithium dose (P less than 0.002) and serum level (P less than 0.01), lithium treatment probably did not by itself cause low folate. Folate level was not related to diagnosis, duration of mental illness, other drug usage or spot affective morbidity. Patients with a good response to lithium in the previous one year had a higher mean serum folate level than those with unsatisfactory response (P less than 0.05). These data suggest that folate deficiency is uncommon among Chinese psychiatric outpatients, but support recent evidence that folate at high concentrations enhances lithium prophylaxis.

Ambulatory Care↗
PubMed1992

Huntington's disease in Chinese: a hypothesis of its origin.

The period prevalence (1984-91) of Huntington's disease (HD) in Hong Kong Chinese was 3.7 per million population. HD patients in Mainland China and Hong Kong showed similar hereditary pattern, clinical and pathological features as in the West. Chinese HD patients were male predominant with a younger age of onset and death. Their ancestral origin could be traced mostly to the coastal provinces of China. It is proposed that Chinese HD patients may have a European origin and share the same gene pool as their white counterparts.

China↗
PubMed1991

Characterization of the memory gene dunce of Drosophila melanogaster.

The dunce (dnc) gene of Drosophila melanogaster encodes cAMP phosphodiesterase (PDEase) and is required for learning/memory and female fertility. The gene is structurally complex, demonstrated in part by Northern blotting experiments which detected multiple RNAs ranging in size from 4.2 to 9.6 kb (1 kb = 10(3) bases or base-pairs). To characterize these RNAs and to understand their sequence heterogeneity, we isolated and analyzed 29 new and independent cDNA clones representing the dnc RNAs. Restriction mapping, hybridization analysis and sequence determination of these cDNA clones and the corresponding genomic exons resolved these into six different classes. Exons defined by the cDNA clones are distributed over more than 148 kb of genomic DNA, with some exons being used alternatively among the RNAs. The RNAs are transcribed from at least three initiation sites: two of these were mapped by parallel S1-nuclease and primer extension experiments. In addition, some of the heterogeneity is generated by using varying lengths of a 3'-untranslated trailer sequence. Altogether, the results indicate that the size and sequence heterogeneity of dnc transcripts results from transcription initiation at multiple sites, alternative splicing, and processes which generate different 3' ends. The existence of multiple protein products is suggested by the alternative use of exons which code for portions of the open reading frame. The protein variation potentially includes N-terminal differences coded for by transcript-specific 5' exons and internal differences arising from the optional inclusion of a 39 base-pair exon and from the alternative use of two 3' splice sites separated by six base-pairs. Expression of a cDNA clone in yeast containing a large portion of the open reading frame produced cAMP PDEase activity identical in properties to the Drosophila enzyme affected by the dnc mutation. The results suggest that the remarkable structural complexity of dnc may reflect an intricate control of the spatial and/or temporal expression of various isoforms of cAMP PDEase.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMed1991

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities.

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1991

Noninvasive temperature imaging using diffusion MRI.

Efficacy and safety considerations for cancer therapy with hyperthermia require accurate temperature measurements throughout the heated volume. We report the use of molecular diffusion, whose temperature dependence is well known. A dedicated hyperthermia applicator was built, combining a MRI gradient coil and a rf coil. Diffusion and derived temperature images were obtained with a 1 x 2 mm pixel size on a polyacrylamide gel phantom using a clinical 1.5-T whole body MRI system. Temperatures determined from these images using 1 cm2 regions of interest were found to be within 0.2 degrees C of those recorded from the thermocouples and fiber-optic probes placed inside the gel.

Body Temperature↗
PubMed1991

Acne as a risk factor for anorexia nervosa in Chinese.

Acne is a highly visible and common skin disorder which is potentially disfiguring and associated with adverse emotional responses in adolescents, who are markedly sensitive to body image changes. Two psychologically vulnerable Chinese girls are reported, in whom traditional health concepts reinforced dieting behaviour, led to weight loss, regression of acne and eventually anorexia nervosa. The intricate interactions of acne, health beliefs, dieting behaviour and eating disorders are discussed.

Achievement↗
PubMed1990

Sleep apnoea presenting as severe hypertension and silent occipital haemorrhage.

A 39-year old Chinese man presented with an acute onset of severe headache, accelerated hypertension and subsequently an unexpected extensive right occipital haemorrhage. These were found to be related to a sleep apnoea syndrome which had been unrecognized for many years despite its typical symptoms of loud snoring and excessive daytime sleepiness. Weight reduction led to significant clinical but not polysomnographic improvement of the sleep apnoea syndrome.

Adult↗
PubMed1990

Narcolepsy in a young Chinese child.

Narcolepsy is characterized by narcoleptic sleep attacks, cataplexy, sleep paralysis and hypnagogic hallucinations. It is very rare in children. A 7-year old Chinese boy presenting with typical narcoleptic symptoms is reported. Diagnosis of narcolepsy usually relies on the clinical picture, the presence of sleep-onset REM periods on nocturnal polysomnograph and the Multiple Sleep Latency Test. The strong association with HLA-DR2 may help in diagnosis, especially in children.

Child↗
PubMed1990

Sleep apnoea syndrome--a study of 5 cases.

Sleep apnoea syndrome (SAS) is common in the West but its prevalence is uncertain in Southeast Asia. Five Chinese patients seen in a Sleep Assessment Unit in Hong Kong are presented to illustrate the spectrum of clinical features and treatment methods involved in obstructive and central sleep apnoea. The first patient is a 45-year old woman with severe obstructive SAS and cardiopulmonary complications who improved significantly after tracheostomy. The second patient is a 43-year old man who improved with weight reduction and protriptyline. The third is a 42-year old man whose SAS did not improve with uvulopalatopharyngoplasty but with continuous positive airway pressure (CPAP). The fourth is a 12-year old girl with obstructive SAS who improved significantly after tonsillectomy. The last patient is a 52-year old man with central SAS who improved with CPAP.

Child↗
PubMed1989

Anorexia nervosa in Hong Kong. Why not more in Chinese?

Anorexia nervosa is a geographically distinct psychiatric disorder; it is rapidly increasing in incidence in Western countries, while being virtually unreported in China, or in the Chinese community of Hong Kong. This is surprising when the Chinese preoccupation with food and their reported readiness to somatise dysphoria are considered. Three Chinese anorectics born and living in Hong Kong and exhibiting mostly typical clinical features are reported. The rarity of the disorder in the East could be related to protective biological and socio-cultural factors specific to the Chinese, and while it may become more common, anorexia nervosa is unlikely to reach Western proportions.

Adolescent↗
PubMed1989

Psychosis in sleep apnoea.

A 30-year-old man presenting with intellectual impairment and recurrent psychotic episodes was subsequently found to have suffered from a chronically untreated obstructive sleep apnoea syndrome. Polysomnography revealed sleep fragmentation, slow wave sleep deprivation and abnormal arterial oxygen desaturation. Tonsillectomy led to complete resolution of sleep apnoea and remission of psychosis at 2 years' follow-up, but his apparent intellectual impairment persisted. The limited literature on psychosis associated with sleep apnoea is briefly reviewed.

Adult↗
PubMed1989

Sleep apnea--an overview.

Though distressing and potentially dangerous, sleep apnea may be an under-recognized disease in many countries. The obstructive type, which usually presents with loud snoring and excessive daytime sleepiness, is by far the commonest form. It causes a great deal of medical, social and psychological morbidity as well as an increased mortality. Doctors of different specialties have an important role in detecting and referring suspected patients for early assessment and treatment. Multidisciplinary management in a general hospital and accurate assessment with polysomnography are essential as modern and sometimes effective methods of treatment are becoming available.

Humans↗
PubMed1986

The field dependence of NMR imaging. I. Laboratory assessment of signal-to-noise ratio and power deposition.

A method is proposed for measuring on the bench the NMR signal-to-noise ratio of rf probes, (over the range 1-100 MHz) and also the power deposited in patients during the imaging experiment. The technique is based on the principle of reciprocity, in that a direct relationship exists between the magnetic field generated (upon transmission) by a matched probe coil and the signal-to-noise ratio delivered by the same coil when used as a receiver. The construction and use of a calibrated sense coil for measuring the field is described, and the precautions and theory necessary for accurate measurement and understanding are outlined. Finally, the method is verified by comparison with a direct spectral measure of sensitivity obtained from a small doped water sample placed in NMR imaging equipment.

Calibration↗
PubMed1986

The field dependence of NMR imaging. II. Arguments concerning an optimal field strength.

Some of the factors involved in the choice of field strength for NMR imaging are examined. The influences of relaxation times and chemical shift upon image quality and signal-to-noise ratio are highlighted, and power deposition is introduced as a significant factor which may limit the flexibility and information available at higher fields as long as 180 degrees echo pulses continue to be necessary. Chemical-shift imaging is examined and found wanting as a means of coping with chemical-shift artifacts, and the use of multiple echoes (albeit with research) in conjunction with multiple-slice techniques is advocated as representing an efficient data-gathering scheme which can improve image signal-to-noise ratio. With such use, a medium field strength (0.5-1 T) is presented as representing, for general purpose imaging of head and torso, the best current compromise when imaging time is of major importance, with the important caveat that new techniques may always invalidate this conclusion.

Fourier Analysis↗
PubMed1986

Molecular analysis of cDNA clones and the corresponding genomic coding sequences of the Drosophila dunce+ gene, the structural gene for cAMP phosphodiesterase.

We have isolated and sequenced cDNA clones representing portions of the polyadenylylated transcripts of the dunce+ gene. These define an open reading frame of 1086 bases and some of the 5'- and 3'-untranslated regions of the transcripts. The deduced amino acid sequence is strikingly homologous to the amino acid sequence of a Ca2+/calmodulin-dependent cyclic nucleotide phosphodiesterase isolated from bovine brain and more weakly related to the predicted amino acid sequence of a yeast cAMP phosphodiesterase. These homologies, together with prior genetic and biochemical studies, provide unambiguous evidence that dunce+ codes for a phosphodiesterase. In addition, the dunce+ gene product shares a seven-amino acid sequence with a regulatory subunit of cAMP-dependent protein kinase that is predicted to be part of the cAMP binding site. We also identify a weak homology between a region of the dunce+ gene product and the egg-laying hormone precursor of Aplysia californica. The open reading frame is divided in the genome by four introns.

3',5'-Cyclic-AMP Phosphodiesterases↗