Plasminogen deficiency: an additional risk factor for thrombosis in a family with factor V R506Q mutation?
Explore the source record for details and available documents.
Adult↗
Biomedical subjects
C Mannhalter
Publications and source records attributed to C Mannhalter.
Thrombotic tendency in 75 symptomatic, unrelated patients with APC resistance.
Resistance to activated protein C (APC resistance) was measured in 284 individuals (169 females, 115 males) with a history of objectively confirmed venous thrombosis and/or pulmonary embolism. A decreased APC resistance ratio was found in 75 patients (26%), 47 were females, 28 males. Factor V Leiden was investigated in 60 of 75 patients with APC resistance, of whom 46 were heterozygous, 4 homozygous. In 10 APC resistant patients the Arg 506 Glu mutation was not identified. The median age of the first thromboembolic event in patients with APC resistance was 42 years (range 15-82 years). Most patients had a history of deep vein thrombosis (83%), 28% had experienced pulmonary embolism. More unusual sites of thrombosis were the deep arm veins (7%) and mesenteric veins (one patient, 1.3%). 53% of patients developed the first thromboembolic event spontaneously. Precipitating conditions for thromboembolism were surgery in 9.3% and trauma in 8%. In one third of female patients the first thromboembolic event occurred in conjunction with pregnancy and delivery (14.8%) or oral contraceptives (19%). At the time of investigation 40% of patients with APC resistance had experienced recurrent thromboembolic events. The family history was positive in 60% of patients. We conclude that the clinical feature of APC resistance is similar to the feature of a deficiency of antithrombin, protein C and protein S. Pregnancy, delivery and oral contraceptives seem to be a relevant additional risk factors for thrombosis in females with APC resistance.
Adolescent↗
[Molecular biology of tobacco smoke associated neoplasia].
Adducts, formed by carcinogens of tobacco smoke with DNA, can be detected by means of molecular techniques and are used as marker of internal exposure. Carcinogen-DNA adducts produce specific mutations in tumor-suppressor genes (e.g. p53) and oncogenes (e.g. ras), which can be involved in tumor initiation or in later stages of tumor progression (e.g. evolution of an invasive phenotype). Benzo(a)-pyrene, an important carcinogen of tobacco smoke, induces GT transversions, as demonstrated in in vitro systems and animal models. Mutations in the p53- or ras-gene are more common in human tumors of the lung, head and neck, bladder and pancreas in smokers than in non-smokers. Molecular biology of cancer gains increasing significance in clinical practice since 1.) the presence of certain mutations confers an unfavorable prognosis to malignant disease (e.g. ras mutations in lung cancer), 2.) ras and p53 mutations often occur early during tumor development and can thus facilitate diagnosis of malignant disease, and 3.) minimal residual disease can be detected using molecular techniques. After resection of cancer of the head and neck, tumor recurred more frequently in patients with no evidence of residual disease as assessed by pathohistologic criteria than in patients with no evidence of residual disease as evaluated by p53 immunostaining.
Carcinogens↗
Protein S deficiency type I: identification of point mutations in 9 of 10 families.
We identified potentially causative mutations in the active protein S gene (PROS 1) by direct sequencing of PROS 1-specific polymerase chain reaction (PRC) products of all 15 exons, including exon-intron boundaries in 10 families with hereditary protein S deficiency type I. Seven different mutations were found in 9 of 10 families, including one frame shift mutation, a previously published splice site mutation (both occurring in two unrelated families), four missense mutations, and a stop codon at the beginning of exon 12. In family studies, cosegregation of the mutation with the disease could be demonstrated for five mutations; for two missense mutations, this was not possible due to limited family data. All seven mutations were the only abnormalities identified in the respective index patients and were absent in 44 to 62 normal individuals. Therefore, they most likely represent the causal gene defects. For five mutations, analysis of ectopic RNA could be performed. Mutant transcripts were present in the case of the frame shift and three of the missense mutations, while no mutant RNA could be detected in the case of the stop codon.
Adolescent↗
Increase of bcr-abl chimeric mRNA expression in tumor cells of patients with chronic myeloid leukemia precedes disease progression.
The translocation t(9;22) in chronic myeloid leukemia (CML) generates a bcr-abl fusion gene that codes for an aberrant chimeric mRNA. Cell lines established from CML patients in blast crisis show higher expression of this aberrant bcr-abl transcript than cells from patients in chronic phase of the disease. This observation provided the stimulus to investigate whether increased expression of the aberrant bcr-abl fusion transcript is critical to the progression of CML from chronic phase to blast crisis. We have monitored the bcr-abl mRNA expression in 25 patients by serial quantitative polymerase chain reaction analyses during a follow-up period of 12 to 156 months after diagnosis, with a median observation time of 28 months. In all patients who have shown disease progression to accelerated phase (n = 4) or blast crisis (n = 7), an increase in bcr-abl mRNA expression was detected up to 16 months before laboratory or clinical parameters showed phenotypic transformation of the malignant clone. To investigate whether the elevated levels of bcr-abl mRNA reflected an increase in the proportion of leukemic cells in the samples analyzed or primarily enhanced transcriptional activity of the bcr-abl fusion gene, we performed quantitative analyses of the bcr-abl gene at the DNA level and of the Ph chromosome at the cytogenetic level and compared these data with steady-state bcr-abl mRNA levels. We show that increased levels of the bcr-abl transcript did not reflect increased proportions of leukemic cells but elevated steady-state levels of the chimeric mRNA in the malignant cells before disease progression. Therefore, our data strongly suggest that an increase of the chimeric mRNA expression in the leukemic cells precedes the phenotypic transformation of the malignant clone.
Adult↗
Diagnosis of Wilson's disease in an asymptomatic sibling by DNA linkage analysis.
The molecular genetic diagnosis of Wilson's disease in the 5-year-old sister of a patient with Wilson's disease is reported. The girl was clinically free of disease and had no conventional biochemical markers of Wilson's disease (i.e., normal ceruloplasmin, normal copper in the serum, normal 24-hour urinary copper excretion). Diagnosis with restriction fragment length polymorphisms and a nonradioactive polymerase chain reaction-based analysis with microsatellite markers showed her to be homozygous for the disease-associated markers. A liver biopsy was performed, and a 20-fold increased liver copper content confirmed the diagnosis. The child was treated with chelation therapy with D-penicillamine. The report of this study clearly shows the advantage of DNA linkage analysis (especially polymerase chain reaction) over conventional laboratory methods for presymptomatic diagnosis of Wilson's disease before irreparable liver and neurological damage occurs. The only limitation of this DNA-based diagnosis is the fact that it is only applicable in siblings of an index patient whose diagnosis was made by phenotypic criteria.
Adult↗
Possible clinical effects of the interaction of hemodialysis membranes with adhesion proteins.
In this study data obtained in an in vitro hemodialysis model are related to various parameters measured in patients' plasma during hemodialysis in a clinical crossover study. In vitro, blood from healthy volunteers was dialyzed under standardized conditions using the capillaries Fresenius MTS C (Cuprophane) and Hospal AN 69 (Polyacrylonitrile). Following dialysis, surface bound proteins were eluted with saline, 1 M Tris and 2% SDS, and analyzed by immunoblotting. Depending on the capillary, different protein patterns could be identified in the eluates. Intact forms of adhesion proteins were predominantly (fibrinogen) or exclusively (vitronectin) found in PA eluates. In contrast, low molecular weight products of fibrinogen as well as high molecular weight components containing antithrombin III (AT III) were present in CP eluates. Their presence may reflect fibrinolytic and procoagulatory activity during dialysis with CP capillaries. A microscopic investigation of CP membranes demonstrated fibrin lined platelet conglomerates. In the plasmas of patients dialyzed with CP capillaries high D-Dimer concentrations were found. We also noticed that during dialysis with PA membranes less heparin was consumed than during dialysis with CP membranes. Our study showed a good correlation of the observations in the vitro system and the measurements in patient samples.
Adsorption↗
[Genetic predisposition for breast carcinoma: overview of molecular genetic principles from long familial epidemiologic observation].
Explore the source record for details and available documents.
Adult↗
Origin of human mast cells: development from transplanted hematopoietic stem cells after allogeneic bone marrow transplantation.
Although mast cells are hematopoietic cells, little is known about the origin of their precursors in vivo. In this study, the origin (donor v recipient genotype) of human mast cells (MCs) was analyzed in a patient who underwent allogeneic bone marrow transplantation (BMT). The patient presented with secondary acute myeloid leukemia (French-American-British classification, M2) arising from refractory anemia with excess of blast cells and bone marrow (BM) mastocytosis. Transplantation was performed in chemotherapy-induced complete remission. On days 88, 126, 198, and 494 after BMT, mast cells were enriched to homogeneity from bone marrow mononuclear cells (BM MNCs) by cell sorting for CD117+/CD34- cells. Purified mast cell populations were CD117(c-kit)+ (> 95%), CD34- (< 1%), CD3- (< 1%), CD14- (< 1%), and virtually free of contaminating cells as assessed by Giemsa staining. The genotype of MCs was analyzed after amplification by polymerase chain reaction (PCR) of a variable number tandem repeat (VNTR) region within intron 40 of the von Willebrand factor (vWF) gene. Unexpectedly, on days 88 and 126 after BMT, sorted MCs displayed recipient genotype as shown by vWF.VNTR-PCR. However, on days 198 and 494, PCR analysis showed a switch to donor genotype in isolated mast cells. Peripheral blood (PB) and BM MNC as well as highly enriched (sorted) CD3+ T cells (PB, BM), CD4+ helper T cells (PB), CD8+ T cells (PB), CD19+ B cells (PB), CD14+ monocytes (PB, BM), and CD34+ precursor cells (BM) showed donor genotype throughout the observation period. Together, these results provide evidence that human MCs developed in vivo from transplanted hematopoietic stem cells. Engraftment and in vivo differentiation of MCs from early hematopoietic progenitor cells may be a prolonged process.
Bone Marrow Transplantation↗
PML-RAR alpha PCR positivity in the bone marrow of patients with APL precedes haematological relapse by 2-3 months.
We report the results of serial tests in three patients with hyperleucocytotic AML M3 by haematological methods, coagulation assays and PCR analyses following treatment with ATRA and chemotherapy. All three patients became PCR negative in bone marrow and peripheral blood (sensitivity level 1 in 10(5) cells) after one cycle of ATRA + chemotherapy. However, they relapsed haematologically 6-9 months after achieving complete haematological remission. The haematological relapse was preceded by PCR positivity in the bone marrow by 3 months. Platelet counts decreased already during CHR, but dropped below normal levels only at the time of relapse. Coagulation parameters were not helpful for early prediction of relapse. Our results demonstrate that PCR analysis in the bone marrow is the best way to monitor patients with APL. However, in hyperleucocytotic patients, PCR negativity does not seem to indicate long-term remission.
Base Sequence↗
Detection of trisomy 12 in chronic lymphocytic leukaemia: comparison of a polymerase chain reaction based technique with fluorescence in situ hybridization.
Trisomy 12 is the most frequent chromosomal aberration in chronic lymphocytic leukaemia (CLL) and seems to indicate a poor prognosis. To detect this abnormality we tested the applicability of the polymerase chain reaction (PCR) and compared it to the current standard fluorescence in situ hybridization (FISH). Two DNA regions containing variable numbers of tandem repeats (VNTR) located on (a) the long and (b) the short arm of chromosome 12 were chosen for PCR analysis. 8/72 patients (11%) were trisomy 12 positive compared to 16% by FISH. Chromosomal imbalances were only detected by PCR if at least 20% of the cells carried the numerical aberration.
Chromosomes, Human, Pair 12↗
Carcinogen-specific mutations in the p53 tumor suppressor gene in lung cancer.
Mutations of the p53 tumor suppressor gene, whose encoded protein is one of the chief regulators of the cell cycle, are proving to be the most common genetic alteration in human cancer. Point mutations have been detected in numerous human solid tumors. The types of point mutations in the p53 gene vary considerably in different kinds of human cancers, suggesting that specific etiologic agents are responsible for typical kinds and sites of mutations in the p53 gene. This study reports the detection of two unusual p53 mutations in a series of patients with lung cancer. The first case showed a one-base pair deletion at the end of exon 8, which is rarely affected by mutations, leading to a frameshift involving the following intron 8, exon 9, and intron 9. The second case exhibited two point mutations in codon 273, both either localized in the same codon on one allele or each mutation localized on a different allele in codon 273. Interestingly, the two mutations can be attributed to different mechanisms of base substitution. This is the first report of this kind. Because of evidence that the nature and site of p53 mutations reflect not only the mutagens involved in tumorigenesis but also the capacity for malignant transformation, the characterization of mutations of the p53 gene may provide a basis for assessing further risk factors, as well as for estimating prognosis in patients with lung cancer.
Adenocarcinoma↗
The prevalence of moderate and severe FXII (Hageman factor) deficiency among the normal population: evaluation of the incidence of FXII deficiency among 300 healthy blood donors.
Factor XII (FXII) deficiency has been reported to be a risk factor for the development of arterial and venous thromboembolism. However, no data are available on the prevalence of FXII deficiency within the normal population. Measuring APTT and FXII activity, seven FXII deficiencies could be detected among 300 healthy blood donors. This corresponds to an incidence of FXII deficiency of 2.3%. On the basis of these data the prevalence of severe and mild FXII deficiency in the normal population can be estimated to be 1.5-3.0%. Assessment of FXII antigen levels revealed, that all seven FXII deficient individuals had FXII antigen levels matching the activity. One presented a severe FXII deficiency (1/300, 0.3%) without detectable FXII activity and an APTT prolongation of more than 120 s. The remaining six FXII deficiencies (6/300, 2.0%) were moderate variations with FXII activities ranging from 20-45% and less prolonged APTTs. Among the 300 healthy donors 16 (5.3%) subjects with prolonged APTTs were identified. Causes for APTT-prolongation were FXII deficiency (7/16), lupus anticoagulant (6/16), mild FVIII deficiency (1/16) and hepatic disorder (1/16). In the remaining sample (1/16) the cause for the prolongation of the APTT remained unexplained. Although 8.7% (26/300) of the donors had a positive family-history of thromboembolism (TE-FHx), none of the FXII deficient subjects were among those with positive TE-FHx.
Adult↗
Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein.
The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
B-Lymphocytes↗
Plasma protein adsorption to hemodialysis membranes: studies in an in vitro model.
Upon interaction of whole blood with foreign materials, heterogeneous protein films are deposited onto the artificial surface (eg, hemodialysis membranes). The composition of these protein films subsequently affects various processes, eg, thrombogenesis or activation of the complement system. We developed an in vitro model with which we can identify and study proteins interacting with capillaries during hemodialysis. Using this model we studied the cuprophane dialyzer GFS 120 (CP) and the polymethylmetacrylate membrane Filtryzer B2-1.2 (PMMA). Heparinized whole blood from healthy young volunteers was dialyzed on an extracorporeal dialysis machine. After the dialysis procedure the adsorbed material was eluted from the hemodialysis membranes by different eluants and subsequently analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. A number of proteins could be identified in the eluates of both membrane types. Interestingly, platelet glycoproteins could only be found in PMMA eluates. Albumin, IgG, and antithrombin III were mainly present in the cuprophane eluates. Fibrinogen was demonstrable in all eluates, but in relatively low amounts, and the protein was significantly degraded. Degradation products of antithrombin III and complement factor 3 could also be identified. The process causing the degradation has not yet been identified, but may be due to proteases released from damaged cells.
Adsorption↗
Modulation of the immunophenotype of ovarian cancer cells by N,N-dimethylformamide and transforming growth factor-beta 1.
Exposure of HOC-7 ovarian adenocarcinoma cells to regulators of cell differentiation caused inducer-dependent alterations of the antigenic pattern of the cells. Immunocytochemistry revealed that N,N-dimethylformamide (DMF) elevated the membrane staining for epidermal growth factor (EGF)-receptor and for desmoplakins I and II. DMF also stimulated cytoplasmic and surface labeling for CA 125 and the deposition of fibronectin into the extracellular matrix. Stimulation of fibronectin was also seen after addition of transforming growth factor (TGF)-beta 1. These responses were quantified using a fixed-cell, enzyme-linked immunosorbent assay (ELISA) and revealed that DMF dose-dependently induced expression of EGF-receptor, CA 125, fibronectin, and desmoplakins I and II. TGF-beta 1 stimulated fibronectin and desmoplakins I and II only. Production of EGF and TGF-alpha was not affected by these inducers. Immunocytochemistry, ELISA and Western blotting showed that both inducers caused down-regulation of myc oncoproteins. DMF was more effective in changing the immunophenotype of HOC-7 cells than TGF-beta 1. Desmoplakins I and II demonstrated elevated epithelial differentiation, whereas fibronectin indicated stimulation of extracellular matrix formation. Elevated EGF-receptor could not compensate for the growth inhibition induced by DMF. The expression of myc oncoproteins was inversely related to cell proliferation. CA 125, however, seems to be unrelated to cell growth.
Blotting, Western↗
Hypergranular acute lymphoblastic leukemia (ALL). Report of a case and review of the literature.
We report a case of adult acute lymphoblastic leukemia (ALL) with myeloid-like hypergranulation of blast cells. Like most of the "granular" ALLs described in the literature, the blast cells had L2 morphology and exhibited a common-ALL immunologic phenotype. The clinical findings at diagnosis were unremarkable. Cytogenetic analysis showed a 46XY karyotype. Molecular genetic analysis revealed T-cell receptor (TCR) gamma and immunoglobulin heavy chain rearrangements; no rearrangement was found at the TCR beta gene locus. The polymerase chain reaction (PCR) for the BCR-ABL translocation was negative. The clinical course of the patient was uncomplicated. On standard ALL treatment protocol he achieved complete remission (CR) within 4 weeks, and he is currently disease free 8 months after diagnosis. The case contributes well-documented data to the characterization of adult "granular" ALL, with special regard to changes at the molecular genetic level.
Adult↗
Twelve novel and two recurrent mutations in 14 Austrian families with hereditary protein C deficiency.
The molecular basis of hereditary type I and type II protein C deficiency was studied in a panel of 14 unrelated Austrian families. By direct sequencing of the nine exons and their splice junctions sequence alterations were found in one of the protein C alleles in all but one subject. In twelve subjects a single alteration was found whereas in one subject one of the protein C alleles carried two sequence abnormalities. Whenever DNA from family members was available (11 of the 14 cases) cosegregation of the protein C deficiency with the mutation was observed. In contrast to what has been found previously in a panel of Dutch patients with hereditary protein C deficiency, none of the 14 mutations occurred in more than one family. Only two of the genetic defects (157Arg-->Stop and 178Arg-->Gln) have been found previously in other geographic locations. These data confirm the large genetic heterogeneity of protein C deficiency.
Amino Acid Sequence↗