Effects of stress on lactation.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
C Lau
Publications and source records attributed to C Lau.
Intraoperative study of polarization and evoked response signals in different endocardial electrode designs.
Some new generation pacemakers use an algorithm based on evoked response (ER) detection to verify beat-to-beat capture and to enable automatic adjustment of output. This is a prospective acute study of polarization signal (PS) and ER in nine currently available electrodes. Intraoperative testing of ventricular bipolar electrodes used the Autocapture (AC) algorithm. The intrinsic R wave, PS, ER, acceptance of AC function, and stimulation thresholds (STs) were obtained. Ventricular electrodes were categorized as follows: titanium nitride (TiN)-coated passive and active fixation, high impedance (HI), passive fixation (VP), iridium oxide-coated titanium (IROX) (VI), and platinum helix (PH) active fixation. Acute testing was performed in 217 patients with an average age of 74.26 years, 59.6% were men with primary pacing indication-SSS (46.3%). There were no significant differences found with respect to R wave and threshold between the various electrodes. PH active-fixation electrodes had significantly higher ER and PS than other groups including the TiN-coated active-fixation electrodes. TiN-coated electrodes (active and passive fixation) had significantly lower PS than other electrodes. As a result, TiN electrodes had a significantly higher functional rate of AC (91.7%), whereas PH had the lowest rate (0%). In conclusion, (1) polarization characteristics are significantly different for commercially available ventricular electrodes, (2) certain physical features at the tissue to electrode interface like TiN coating appears to be more important in determining PS than electrode tip size and fixation method, and (3) the current algorithm for AC requires electrodes that provide low polarization for satisfactory performance.
Adult↗
Toward a biologically based dose-response model for developmental toxicity of 5-fluorouracil in the rat: acquisition of experimental data.
Biologically based dose-response (BBDR) models represent an emerging approach to improving the current practice of human health-risk assessment. The concept of BBDR modeling is to incorporate mechanistic information about a chemical that is relevant to the expression of its toxicity into descriptive mathematical terms, thereby providing a quantitative model that will enhance the ability for low-dose and cross-species extrapolation. Construction of a BBDR model for developmental toxicity is particularly complicated by the multitude of possible mechanisms. Thus, a few model assumptions were made. The current study illustrates the processes involved in selecting the relevant information for BBDR modeling, using an established developmental toxicant, 5-fluorouracil (5-FU), as a prototypic example. The primary BBDR model for 5-FU is based on inhibition of thymidylate synthetase (TS) and resultant changes in nucleotide pools, DNA synthesis, cell-cycle progression, and somatic growth. A single subcutaneous injection of 5-FU at doses ranging from 1 to 40 mg/kg was given to pregnant Sprague-Dawley rats at gestational day 14; controls received saline. 5-FU was absorbed rapidly into the maternal circulation, and AUC estimates were linear with administered doses. We found metabolites of 5-FU directly incorporated into embryonic nucleic acids, although the levels of incorporation were low and lacked correlation with administered doses. On the other hand, 5-FU produced dose-dependent inhibition of thymidylate synthetase in the whole embryo, and recovery from enzyme inhibition was also related to the administered dose. As a consequence of TS inhibition, embryonic dTTP and dGTP were markedly reduced, while dCTP was profoundly elevated, perhaps due to feedback regulation of intracellular nucleotide pools. The total contents of embryonic macromolecules (DNA and protein) were also reduced, most notably at the high doses. Correspondingly, dose-related reductions of fetal weight were seen as early as GD 15, and these deficits persisted for the remainder of gestation. These detailed dose-response parameters involved in the expression of 5-FU developmental toxicity were incorporated into mathematical terms for BBDR modeling. Such quantitative models should be instrumental to the improvement of high-to-low dose and cross-species extrapolation in health-risk assessment.
Abnormalities, Drug-Induced↗
Toward a biologically based dose-response model for developmental toxicity of 5-fluorouracil in the rat: a mathematical construct.
Biologically based dose-response (BBDR) models comprise one way to incorporate mechanistic information into a dose-response assessment to be used for risk assessments. The chemotherapeutic drug 5-fluorouracil (5-FU) has been used as a prototypic compound for the construction of a BBDR model for developmental toxicity. Previous work has provided data and a general mechanistic framework for the developmental toxicity of 5-FU when it was administered to pregnant rats subcutaneously on gestation day 14. In this paper, a mathematical model relating maternally administered treatment with 5-FU to embryonal thymidylate synthetase inhibition and thymidylate synthetase inhibition to various measures of deoxyribonucleotide triphosphate (dNTP) pool perturbation is developed, and parameters are estimated using the data collected. The strategy used was to develop semi-empirical submodels for each of the intervening steps, and to estimate model parameters from previously described data. The models developed predict that there is no practical threshold for dNTP pool perturbation; that is, even minimal doses of 5-FU should result in some perturbation of dNTP pools. In particular, the relationship between dNTP pool perturbation and fetal weight deficit suggests that if there is a biological threshold for the effect of 5-FU on fetal weight, the responsible repair or compensation mechanism must be downstream of dNTP pool perturbation, and saturable at 5-FU doses lower than 10 mg/kg (the lowest dose examined for developmental effects in these studies).
Abnormalities, Drug-Induced↗
Serum vascular endothelial growth factor predicts venous invasion in hepatocellular carcinoma: a prospective study.
OBJECTIVE: To evaluate the correlation between serum vascular endothelial growth factor (VEGF) level and the clinicopathologic features in patients with hepatocellular carcinoma (HCC). SUMMARY BACKGROUND DATA: VEGF is an important angiogenic factor regulating tumor angiogenesis. A high serum VEGF level has been shown to be associated with tumor progression and metastasis in several human cancers, but its significance in HCC is unclear. The correlation between serum VEGF level and tumor pathologic features in patients with HCC has not been studied before. METHODS: Preoperative serum samples and tumor specimens were prospectively collected in 100 patients undergoing resection of HCC. Serum VEGF level was measured by enzyme-linked immunosorbent assay, and tumor VEGF expression was assessed by immunohistochemical study. Histopathologic examination was performed by a pathologist without prior knowledge of the serum VEGF level or tumor VEGF expression. RESULTS: Preoperative serum VEGF levels ranged from 15 to 1,789 pg/mL (median 269). When serum VEGF levels were compared between groups categorized by different clinicopathologic variables, significant correlation was found between a high serum VEGF level and absence of tumor capsule, presence of intrahepatic metastasis, presence of microscopic venous invasion, and advanced stage. There was a positive correlation between the serum VEGF level and tumor expression of VEGF as well as platelet count. When the 75th percentile serum VEGF level (500 pg/mL) was used as a cutoff level, the frequency of venous invasion in patients with a high serum VEGF level was significantly greater compared with patients with a low serum VEGF level. By multivariate analysis, a serum VEGF level of more than 500 pg/mL and tumor size more than 5 cm were independent preoperative factors predictive of microscopic venous invasion. During a median follow-up of 11.6 months, 48% of patients with a serum VEGF level of more than 500 pg/mL and 27% of those with a serum VEGF level of 500 pg/mL or less developed postoperative recurrence. CONCLUSIONS: These results show that a high preoperative serum VEGF level is a predictor of microscopic venous invasion in HCC, suggesting that the serum VEGF level may be useful as a biologic marker of tumor invasiveness and a prognostic factor in HCC.
Adult↗
Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.
Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.
3' Untranslated Regions↗
Effects of physiologic pacing versus ventricular pacing on the risk of stroke and death due to cardiovascular causes. Canadian Trial of Physiologic Pacing Investigators.
BACKGROUND: Evidence suggests that physiologic pacing (dual-chamber or atrial) may be superior to single-chamber (ventricular) pacing because it is associated with lower risks of atrial fibrillation, stroke, and death. These benefits have not been evaluated in a large, randomized, controlled trial. METHODS: At 32 Canadian centers, patients without chronic atrial fibrillation who were scheduled for a first implantation of a pacemaker to treat symptomatic bradycardia were eligible for enrollment. We randomly assigned patients to receive either a ventricular pacemaker or a physiologic pacemaker and followed them for an average of three years. The primary outcome was stroke or death due to cardiovascular causes. Secondary outcomes were death from any cause, atrial fibrillation, and hospitalization for heart failure. RESULTS: A total of 1474 patients were randomly assigned to receive a ventricular pacemaker and 1094 to receive a physiologic pacemaker. The annual rate of stroke or death due to cardiovascular causes was 5.5 percent with ventricular pacing, as compared with 4.9 percent with physiologic pacing (reduction in relative risk, 9.4 percent; 95 percent confidence interval, -10.5 to 25.7 percent [the negative value indicates an increase in risk]; P=0.33). The annual rate of atrial fibrillation was significantly lower among the patients in the physiologic-pacing group (5.3 percent) than among those in the ventricular-pacing group (6.6 percent), for a reduction in relative risk of 18.0 percent (95 percent confidence interval, 0.3 to 32.6 percent; P=0.05). The effect on the rate of atrial fibrillation was not apparent until two years after implantation. The observed annual rates of death from all causes and of hospitalization for heart failure were lower among the patients with a physiologic pacemaker than among those with a ventricular pacemaker, but not significantly so (annual rates of death, 6.6 percent with ventricular pacing and 6.3 percent with physiologic pacing; annual rates of hospitalization for heart failure, 3.5 percent and 3.1 percent, respectively). There were significantly more perioperative complications with physiologic pacing than with ventricular pacing (9.0 percent vs. 3.8 percent, P<0.001). CONCLUSIONS: Physiologic pacing provides little benefit over ventricular pacing for the prevention of stroke or death due to cardiovascular causes.
Aged↗
Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?
Glucocorticoids play a key role in controlling numerous cellular processes during embryogenesis and fetal development. Excess glucocorticoids during development have been linked to dysmorphogenesis and/or intrauterine growth impairment in rodents. The actions of glucocorticoids are mediated by interaction with their receptors. Negative feedback regulation of glucocorticoid receptor (GR) is important for limiting cellular sensitivity to the hormones. Hence, acute exposure of the adult rat to the synthetic glucocorticoid dexamethasone (DEX) reduced both GR mRNA and protein in a variety of tissues that include hippocampus and liver, in a dose- and time-dependent fashion. Reduction in GR mRNA and protein were observable when DEX was given repeatedly at doses as low as 0. 05 mg/kg. In the control whole rat embryo, GR mRNA was low but measurable at as early as gestational day (GD) 10, but underwent rapid ontogenetic increase in the ensuring days. In contrast to the adult, neither GR mRNA nor protein in the whole rat embryo was affected by acute or repeated DEX administration to pregnant rats on GD10-13, even at doses as high as 0.8 mg/kg. Similar results were obtained in embryonic palate and liver, tissues known to be glucocorticoid targets. These data suggest that GR autoregulation does not occur during organogenesis in the rat. Accordingly, hormonal elevations from stress or chemical insults can be transduced unrestrictedly, ultimately leading to aberrant cell function and development. The unique mode of GR regulation seen in the embryonic cells may provide a potential common mechanism for developmental perturbation and toxicity for a variety of insults.
Analysis of Variance↗
Role of endothelium in thapsigargin-induced arterial responses in rat aorta.
We assessed the role of endothelium in the arterial response to thapsigargin, the Ca(2+)-ATPase inhibitor of the endoplasmic reticulum, in rat isolated aortic rings. Thapsigargin induced an endothelium-dependent relaxation of phenylephrine-contracted aortic rings with an EC(50) of 2.6+/-0.4 nM and a 75% maximum relaxation, while it was less effective against 30 mM K(+)-induced contraction. Pretreatment of aortic rings with N(G)-nitro-L-arginine methyl ester (30 microM) or methylene blue (1 microM) reduced thapsigargin-induced relaxation by approximately 85%. Thapsigargin failed to relax the endothelium-denuded rings. L-Arginine (3 mM) partially, but significantly, antagonized the effect of 30 microM N(G)-nitro-L-arginine methyl ester. Pretreatment with indomethacin (3 microM), glibenclamide (1 microM) or iberiotoxin (100 nM) did not alter the thapsigargin-induced relaxation. In contrast, pretreatment with tetrapentylammonium ions (TPA(+), 1-3 microM) or with 300 microM Ba(2+) suppressed the relaxant response to thapsigargin. TPA(+) (3 microM) also attenuated acetylcholine-induced relaxation. Thapsigargin-induced endothelium-dependent relaxation was primarily dependent on the presence of extracellular Ca(2+). Interestingly, when the tissues were exposed to very low concentrations of thapsigargin (1-3 nM) the nitric oxide-dependent relaxation induced by acetylcholine or A23187 was markedly reduced. While thapsigargin (3 nM) did not influence the relaxation induced by endothelium-independent dilators, sodium nitroprusside and verapamil. These results indicate that thapsigargin produced complex vascular effects primarily by acting on the endothelial cells. Thapsigargin causes an endothelial nitric oxide-dependent relaxation; on the other hand, it inhibits nitric oxide-mediated relaxation at the similar concentrations. Activation of TPA(+)- and Ba(2+)-sensitive but not Ca(2+)-activated or ATP-sensitive K(+) channels may be also involved in thapsigargin-induced relaxation of rat isolated aortic rings.
Animals↗
A review of antimycobacterial natural products.
Tuberculosis is a chronic infectious disease caused by several species of mycobacteria. Due to multi-drug resistant strains of mycobacteria and to a high prevalence of tuberculosis in patients who have acquired human immunodeficiency syndrome (AIDS), the number of patients infected with the disease is increasing worldwide. Thus there is an urgent need for new effective antimycobacterial agents to replace those currently in use. In this instance, the plant kingdom is undoubtedly a valuable source for new anti-tuberculosis agents. The present review article reports the findings from an extensive literature search of all plants that have been assessed for antimycobacterial/antitubercular activity over the past 20-30 years. An attempt has been made to summarize the information in order to highlight those promising plant species which are worthy of further investigation as leads for drug development. Over 350 plant species from a wide range of families and origins, containing various chemical classes of compounds, have been screened for such activity. A review of the relevant in vitro assays using different species of pathogenic and non-pathogenic mycobacteria is also included.
Antitubercular Agents↗
Evaluation of biologically based dose-response modeling for developmental toxicity: a workshop report.
Biologically based dose-response (BBDR) modeling represents a novel approach for quantitative assessment of health risk by incorporating pharmacokinetic and pharmacodynamic characteristics of a chemical and by relating the immediate cellular responses to a cascade of aberrant biological actions that leads to detectable adverse outcomes. The quantitative relationship of each of the intervening events can be described in mathematical forms that are amenable for adjustment and extrapolation over a range of doses and across species. A team of investigators at the Reproductive Toxicology Division of the U.S. Environmental Protection Agency has explored the feasibility of BBDR modeling by examining the developmental toxicity of a known teratogen, 5-fluorouracil. A panel of researchers from academic and industrial laboratories, biomathematical modelers, and risk assessment scientists was convened in a workshop to evaluate the approaches undertaken by the EPA team and to discuss the future prospects of BBDR modeling. This report summarizes the lessons learned from one approach to BBDR modeling and comments from the panelists: while it is possible to incorporate mechanistic information into quantitative dose-response models for the assessment of health risks, the process is enormously data-intensive and costly; in addition, the confidence of the model is directly proportional to our current understanding of basic biology and can be enhanced only through the ongoing novel discoveries. More importantly, the extent of "uncertainty" (inherent with the default assumptions associated with the NOAEL or benchmark approach) reducible by BBDR modeling requires further scrutiny and comparison.
Abnormalities, Drug-Induced↗
Non-steroidal anti-inflammatory drug toxicity in the upper gastrointestinal tract.
Non-steroidal anti-inflammatory drug (NSAID) toxicity in the upper gastrointestinal tract is the most common serious drug-induced toxicity reported to drug regulatory authorities. In the last two decades, the rediscovery of H. pylori, development of potent ulcer-healing drugs and specific Cox-II inhibitors have opened new horizons in the management of NSAID toxicity. A Working Party composed of gastroenterologists and rheumatologists in the Asia-Pacific region met in Cairns, Australia, in 1999 to review the literature and develop appropriate guidelines. Recommendations were made based on the latest existing evidence. The importance of clinical events as study endpoints was emphasized. While differences exist between NSAIDs and aspirin, most studies have shown that advanced age, history of peptic ulcer disease, serious concomitant illnesses and coprescription of NSAID/aspirin with anticoagulants and steroids are high risk factors. These patients should be considered for prophylactic anti-ulcer therapy. Helicobacter pylori infection may aggravate the toxicity of NSAIDs and, in selected cases, should be treated before NSAID/aspirin is prescribed. Proton pump inhibitors and misoprostol are the most promising agents in preventing gastric and duodenal ulcers. When NSAID/aspirin needs to be continued in patients who develop an NSAID-related ulcer, proton pump inhibitors offer the best healing effect. With the discovery of cyclo-oxygenase isoforms (Cox-I and Cox-II), preferential and specific Cox-II inhibitors have been developed. While early clinical data have suggested promising antiinflammatory effects and improved safety profile in the gastrointestinal tract, several key issues on long-term safety remain unresolved. The use of potent anti-ulcer therapy, treatment of H. pylori infection and the development of Cox-II inhibitor will change the scenario of NSAID/aspirin-related gastrointestinal toxicity in the next millennium.
Anti-Inflammatory Agents, Non-Steroidal↗
Oral feeding in premature infants: advantage of a self-paced milk flow.
An earlier study demonstrated that oral feeding of premature infants (<30 wk gestation) was enhanced when milk was delivered through a self-paced flow system. The aims of this study were to identify the principle(s) by which this occurred and to develop a practical method to implement the self-paced system in neonatal nurseries. Feeding performance, measured by overall transfer, duration of oral feedings, efficiency, and percentage of successful feedings, was assessed at three time periods, when infants were taking 1-2, 3-5, and 6-8 oral feedings/day. At each time period, infants were fed, sequentially and in a random order, with a self-paced system, a standard bottle, and a test bottle, the shape of which allowed the elimination of the internal hydrostatic pressure. In a second study, infants were similarly fed with the self-paced system and a vacuum-free bottle which eliminated both hydrostatic pressure and vacuum within the bottle. The duration of oral feedings, efficiency, and percentage of successful feedings were improved with the self-paced system as compared to the standard and test bottles. The results were similar in the comparison between the self-paced system and the vacuum-free bottle. Elimination of the vacuum build-up naturally occurring in bottles enhances the feeding performance of infants born <30 wk gestation as they are transitioned from tube to oral feeding. The vacuum-free bottle is a tool which caretakers can readily use in neonatal nurseries.
Equipment Design↗
Feeding tolerance in premature infants fed fortified human milk.
BACKGROUND: To evaluate feeding tolerance in premature infants immediately after the addition of human milk fortifier (HMF) to their expressed human milk diet. METHODS: Data on milk intake, feeding tolerance, and related assessments and growth milestones from a prospective study of feeding strategies in premature infants were analyzed. The database was searched for the first day HMF was added to the feeding of infants receiving human milk exclusively. The following assessments were tabulated for the 5 days before and the 5 days after the addition of HMF: milk intake, the number of episodes of abdominal distension, gastric residual volume (GRV) more than 2 ml/kg and more than 50% of the volume fed in the prior 3 hours. bile-stained gastric residual, emesis or regurgitation, blood in the stool, the number of abdominal radiographs, the number of episodes of apnea and bradycardia, changes in findings in the clinical examination, and the number of hours feeding was withheld. The time to achieve full tube feeding, complete oral feeding, and hospital discharge were recorded. RESULTS: Seventy-six exclusively human milk-fed premature infants (birth weight, 1065+/-18 g; gestational age, 27+/-0.1 weeks; mean +/- SEM) who received HMF beginning 22+/-0.8 days of age were evaluated. There were significant increases in milk intake and in the number of episodes of GRV more than 2 ml/kg and emesis after the addition of HMF. There were no differences in the number of hours feeding was withheld or any other assessment after the addition of HMF. Infants with increases in GRV more than 2 ml/kg and/or emesis after the addition of HMF were not more likely to be delayed in the time to achieve full tube feeding, complete oral feeding, or hospital discharge than infants who did not experience these events. CONCLUSION: These data suggest that, when all feeding and related assessments and the time to achieve important growth milestones are considered, the addition of HMF does not adversely affect the outcome of the premature infant.
Enteral Nutrition↗
A cardiac evoked response algorithm providing threshold tracking: a North American multicenter study. Clinical Investigators of the Microny-Regency Clinical Evaluation Study.
The purpose of this study was to evaluate a pacing system using the recognition of cardiac evoked response for the automatic adjustment of pacing output. Patients were prospectively followed after primary implantation of VVIR pacemakers using AutoCapture (St. Jude Medical CRMD). Sensing and pacing thresholds, polarization signal, evoked response, and AutoCapture performance were evaluated with serial visits and 24-hour Holter monitoring. Three hundred ninety-eight patients (mean age 71 +/- 15 years) were followed for an average duration of 1 year (3 days-1.75 years) with the algorithm functional in > 90% of patients. Backup pacing in the event of exit block was confirmed in all patients. Pacing thresholds remained stable at 0.89 +/- 0.34 V with a pulse width of 0.31 ms (with chronic output autoset at 0.3 V above the actual threshold). Evoked response exhibited a small but statistically significant increase with time (8.92 mV at implant, 9.60 mV at 12 months), however, this finding did not result in any change in AutoCapture function during our follow-up period. The polarization signal remained stable with minimal variation (1.12 mV at implant, 1.18 at 12 months). No clinical adverse events were observed using the AutoCapture algorithm. In this initial experience with the AutoCapture algorithm the evoked response and polarization measurements remained adequate, allowing the system to function in the majority of patients with safe, low output pacing. High energy backup pacing provided an added safety feature over fixed output devices in cases of unexpected threshold rises. Longer follow-up is required for continued long-term validation of the algorithm.
Aged↗
Biologically based risk assessment models for developmental toxicity.
It is obvious that the task of incorporating mechanistic information into dose-response assessment for developmental toxicity is, by and large, still at its conceptual stage. Our immature understanding of embryogenesis and teratogenesis forces us to make simplifying biological assumptions that may turn out to be erroneous; therefore, these mechanistically based models should be constructed so as to be easily modified as new information becomes available. The data-intensive (and costly) nature of these modeling efforts may also limit their practice to extraordinary situations where, for instance, large segments of the human population are exposed to low levels of a compound and the determination of a safe level of exposure is of utmost importance, or where compounds are of such immense economic or therapeutic value that their use would warrant a concerted effort to minimize the uncertainties inherent in the current methods of extrapolation. Nevertheless, this chapter has presented several attempts to translate the concept of BBDR into practice. When these applications become successful, these models should provide risk assessors with more reliable response indicators at low doses (where human exposures are realistic) and more accurate cross-strain/cross-species comparisons as well as extrapolations across exposure conditions. Although the BBDR models do not necessarily redefine the current practice of risk assessment using either the NOAEL or the benchmark approach, information derived from these efforts should provide a credible scientific basis for the estimates of RfD.
Animals↗
Characterization of the developmental stages of sucking in preterm infants during bottle feeding.
It is acknowledged that the difficulty many preterm infants have in feeding orally results from their immature sucking skills. However, little is known regarding the development of sucking in these infants. The aim of this study was to demonstrate that the bottle-feeding performance of preterm infants is positively correlated with the developmental stage of their sucking. Infants' oral-motor skills were followed longitudinally using a special nipple/bottle system which monitored the suction and expression/compression component of sucking. The maturational process was rated into five primary stages based on the presence/absence of suction and the rhythmicity of the two components of sucking, suction and expression/compression. This five-point scale was used to characterize the developmental stage of sucking of each infant. Outcomes of feeding performance consisted of overall transfer (percent total volume transferred/volume to be taken) and rate of transfer (ml/min). Assessments were conducted when infants were taking 1-2, 3-5 and 6-8 oral feedings per day. Significant positive correlations were observed between the five stages of sucking and postmenstrual age, the defined feeding outcomes, and the number of daily oral feedings. Overall transfer and rate of transfer were enhanced when infants reached the more mature stages of sucking. We have demonstrated that oral feeding performance improves as infants' sucking skills mature. In addition, we propose that the present five-point sucking scale may be used to assess the developmental stages of sucking of preterm infants. Such knowledge would facilitate the management of oral feeding in these infants.
Bottle Feeding↗