[Neuroelectrophysiological study serves as an indicator of neuromuscular changes in treating hypothyroidism].
Explore the source record for details and available documents.
Adult↗
Biomedical subjects
C L Lai
Publications and source records attributed to C L Lai.
Placebo-controlled trial of recombinant alpha 2-interferon in Chinese HBsAg-carrier children.
24 Chinese children aged 1.5-5 years and positive for hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), hepatitis B virus DNA polymerase (HBV DNAp), and HBV DNA on at least three occasions in the 6 months before the trial were randomised to receive either vitamin B complex or intramuscular recombinant alpha 2-interferon (r-IFN) ('Roferon') 10 X 10(6) IU/m2 thrice weekly for 12 weeks. In all 12 subjects receiving r-IFN, HBV DNAp and HBV DNA levels fell during the course of r-IFN injections. Within 4 weeks of cessation of r-IFN injection, the HBV DNAp and HBV DNA returned to pre-trial levels except in 2 subjects, in whom loss of HBV DNAp and HBV DNA was sustained for up to 18 months from onset of the trial. 1 child lost HBeAg at 18 months. 2 of the 12 children in the placebo group also had a sustained loss of HBV DNAp and HBV DNA during the 18 months, with 1 child losing HBeAg at 18 months. All 24 subjects remained positive for HBsAg. r-IFN produced very slight side-effects except for pyrexia and the "flu" syndrome, both of which showed rapid tachyphylaxis. In the dose given r-IFN was safe but had no long-term beneficial effects on HBsAg carriage in Chinese children.
Carrier State↗
Hepatocellular carcinoma in Chinese males and females. Possible causes for the male predominance.
The male-female ratio in 186 hepatocellular carcinoma (HCC) Chinese patients was 5:1. The clinical presentation, biochemical parameters, and histologic findings were the same in both sexes except for a higher proportion of underlying cirrhosis (P = 0.02), and spider naevi (P = 0.04) in the men. There were also more smokers and alcohol drinkers among the men. Over 75% of both sexes were positive for the hepatitis B surface antigen. The possible contributory factors to the predominance of males to females in HCC included: the association with the hepatitis B virus, the higher proportion of male cirrhotics, smoking, and alcohol drinking. The survival probability for both sexes was equally poor; the median survival was 8 weeks for males and 10 weeks for females.
Actuarial Analysis↗
Persistence of Campylobacter pyloridis despite healing of duodenal ulcer and improvement of accompanying duodenitis and gastritis.
Campylobacter pyloridis has been associated with antral gastritis and duodenal ulcer. To study the pathogenetic role of these organisms in duodenal ulcer, endoscopic biopsies, two from the first part of duodenum, four from antrum, and four from body and fundus, were taken before and after four weeks of cimetidine treatment (1.2 g/day) from 67 patients with active duodenal ulcer. The biopsies were examined for the presence and severity of any inflammation by two independent pathologists in the absence of any clinical information and for the occurrence and density of Campylobacter pyloridis by culture and Warthin-Starry stain. Before treatment, inflammation was present in 71.1, 100, and 25.8%, while the organisms were present in 34.3, 91.0, and 79.1% of the duodenal, antral, and fundal biopsies, respectively. With complete healing of duodenal ulcer, inflammation was present in 48.9, 98.2, and 30.2%, while the organisms were present in 25, 76.7, and 63.3% of the respective mucosae. With ulcer healing, duodenitis became significantly milder (P less than 0.05). With improvement of gastritis and duodenitis, there was no significant change in the occurrence and density of Campylobacter pyloridis. These findings indicate that healing of duodenal ulcer is not influenced by the presence of Campylobacter pyloridis, which is frequently found in the gastroduodenal mucosa of patients with duodenal ulcer, but does not appear to be associated with mucosal inflammation except in the antrum.
Adult↗
Spontaneous hepatitis B e antigen to antibody seroconversion and reversion in Chinese patients with chronic hepatitis B virus infection.
Five hundred twelve (373 men, 139 women) patients, aged 1-75 yr, with chronic hepatitis B virus infection seen during a 5-yr period were analyzed. Of these, 43.8% were hepatitis B e antigen (HBeAg)-positive, 49.2% were positive for hepatitis B e antibody, and 7% were negative for both HBeAg and hepatitis B e antibody at presentation. The cumulative probability of clearing HBeAg at the end of the first, second, and third years was 17%, 30%, and 34%, respectively. The probability of clearing HBeAg increased with the age of the patients. Reversion to HBeAg occurred in 7.8% of patients who were HBeAg-negative at presentation and 32.3% of HBeAg-positive patients who cleared HBeAg. In 70.6% of these patients, serum hepatitis B virus-deoxyribonucleic acid was persistently positive or became detectable at the time of HBeAg reversion. Most reversions occurred during the "e-window" phase. The reversions were transient in 31.8% of the cases. Recognition of the dynamics of these serologic changes is important in the evaluation of therapeutic regimens aimed at suppression of HBV replication and call for controlled trials with adequate duration of follow-up. Biochemical exacerbation of liver disease accompanied 38.7% of HBeAg to hepatitis B e antibody seroconversions and 34.8% of reversions. Such exacerbations may be mistaken for acute attacks of hepatitis B in patients not previously recognized to be hepatitis B surface antigen carriers and, in the absence of serial serologic data, are indistinguishable from superimposed non-A, non-B hepatitis.
Adolescent↗
An oligonucleotide probe for the detection of hepatitis B virus DNA in serum.
A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.
Animals↗
Sucralfate overcomes adverse effect of cigarette smoking on duodenal ulcer healing and prolongs subsequent remission.
A unicenter, single-blind, randomized study was conducted on 283 patients with active duodenal ulcer to compare possible factors that may affect healing and relapse in patients treated with a potent antisecretory agent, cimetidine, or a site-protective and cytoprotective agent, sucralfate. The endoscopic healing rates at 4 wk were 76% and 79%, respectively, and cross-over treatment of the failures for a further 4 wk resulted in 68% healing with cimetidine and 69% healing with sucralfate, both differences being not statistically different. Unlike cimetidine, healing by sucralfate was unaffected by cigarette smoking, reluctance to give up smoking, habitual use of alcohol, high maximal acid output, and large ulcer diameter. In particular, the healing rate of smokers treated with sucralfate (82%) was significantly greater than that of smokers treated with cimetidine (63%). Duodenal bulb deformity significantly affected healing in both groups, and was the only offsetting factor identifiable for sucralfate out of 46 factors examined. Of the patients with healed ulcers, 238 participated in a 24-mo follow-up study consisting of interviews at 2-mo intervals and endoscopy at 4-mo intervals or whenever symptoms recurred. The cumulative relapse rate was significantly (p less than 0.007) greater in patients healed with cimetidine than with sucralfate, 50% relapse occurring at 6 and 12 mo, respectively. In both, the cumulative relapse rate was significantly greater in cigarette smokers than in nonsmokers, but smokers and nonsmokers treated with cimetidine relapsed (50% at 4 and 8 mo, respectively) faster than the corresponding smokers and nonsmokers treated with sucralfate (50% at 8 and 18 mo, respectively). Furthermore, in cimetidine- but not sucralfate-healed patients, early ulcer relapse (within 6 mo) was associated with short duration of illness, short remission period, long symptomatic spell, and reluctance to give up smoking. We conclude that smoking adversely affects duodenal ulcer healing by cimetidine and hastens subsequent relapse, and that sucralfate overcomes the adverse effect of smoking on healing as encountered with cimetidine, and results in a subsequent remission period double that of cimetidine.
Adult↗
Hepatitis B virus infection in Chinese families in Hong Kong.
Between January 1983 and July 1984, 731 family members of 240 hepatitis B surface antigen (HBsAg) carriers were screened for hepatitis B virus markers. The percentage of those who were positive for HBsAg was 28.3 and that for antibody to hepatitis B surface antigen/antibody to hepatitis B core antigen was 43.1. The carrier rate was higher among siblings (53%) and offspring (50.5%) of female carriers, but similar to that of the age-matched general population for spouses (10.8%). Maternal transmission was the most important mode of spread of hepatitis B virus infection within the family. The HBsAg-positive offspring and siblings were clustered within certain families. Intrafamilial spread is important in perpetuating hepatitis B virus infection in Chinese persons. Susceptible family members, especially newborns and other young children of female carriers, should be vaccinated.
Adolescent↗
Non-Hodgkin's lymphoma as a cause of hypoadrenalism.
Non-Hodgkin's lymphoma which presents as adrenocortical insufficiency is rare, however, it should be a well-recognised entity because, in addition to specific chemotherapy or radiotherapy, it needs hormonal replacement. We report a patient with diffuse histiocytic lymphoma, who had remission for seven years and relapsed with Addisonian crisis.
Adrenal Gland Neoplasms↗
Sucralfate versus cimetidine in duodenal ulcer--factors affecting healing and relapse.
An understanding of the factors affecting duodenal ulcer healing by different pharmacological agents should give some insight into the underlying pathophysiology of healing.
Cimetidine↗
Intrahepatic cholestasis associated with an enlarged gall-bladder.
A 60-year-old man with a history of ingesting herbal medication and a 59-year-old woman with malignant lymphoma presented with painless jaundice and palpably enlarged gall-bladders. Abdominal ultrasonography confirmed that the gall-bladders were enlarged, but showed normal-sized biliary trees with no stones. The final diagnoses for these patients were drug-induced hepatitis with intrahepatic cholestasis and lymphomatous infiltration of the liver, respectively. A palpable gall bladder in cholestatic jaundice may not always be caused by extrahepatic biliary obstruction, and ultrasonography is very useful in ruling this out.
Cholangiopancreatography, Endoscopic Retrograde↗
Response to hepatitis B vaccine in family members of HBsAg carriers.
The family members of HBsAg carriers have an increased risk of hepatitis B virus (HBV) infection. 214 subjects from 98 families with no HBV markers were randomized to receive hepatitis B vaccine: HEVAC B (Institute Pasteur) or GCC VAC (Green Cross Corporation) at 0, 1, and 5 months. Of those who completed the course, 87.8% had an anti-HBs response of greater than 10 mIU/ml at 6 months. The response rate was similar for both sexes. There was a decrease in response rate and anti-HBs titre with age. The response rate for HEVAC B was 92.5% and GCC VAC 84.3%. The offspring had comparable response to the spouses who were not blood relatives of the index carriers, but this could be related to their younger age. Discriminant analysis showed that a higher anti-HBs titre was associated with HEVAC B, younger age, and less direct relationship with the index carrier.
Adolescent↗
Prostaglandin E1 (misoprostol) overcomes the adverse effect of chronic cigarette smoking on duodenal ulcer healing.
Chronic cigarette smoking adversely affects duodenal ulcer healing despite treatment by potent gastric acid-reducing agents. Prostaglandins of the E series possess antisecretory and cytoprotective properties and theoretically offer advantages over existing therapeutic agents. A double-blind randomized study was performed to compare complete duodenal ulcer healing as assessed by endoscopies every two weeks for up to 12 weeks. Two hundred twenty-nine patients were randomized to receive misoprostol, an orally stable synthetic derivative of prostaglandin E1, in 200-micrograms or 300-micrograms qid dosages, or placebo. Life-table analysis showed that (1) both regimens of misoprostol were significantly more effective than placebo, achieving healing rates of 61% and 71%, respectively, at four weeks, and (2) cigarette smoking significantly impaired healing by placebo but not by misoprostol. In fact, the time-healing curves of smokers and nonsmokers on the higher dose of misoprostol completely overlapped. Furthermore, delayed treatment and large ulcer diameter adversely affected healing by misoprostol in smokers, whereas in nonsmokers, high basal and maximal acid output were unfavorable. Misoprostol is recommended for the treatment of duodenal ulcer, particularly in chronic smokers early in a given period of symptoms.
Adult↗
Chronic antral gastritis in duodenal ulcer. Natural history and treatment with prostaglandin E1.
The natural history of chronic antral gastritis in relation to the healing of duodenal ulcer and its response to treatment, if any, are unknown. We performed a double-blind controlled trial using an oral prostaglandin E1, misoprostol, in 229 patients with active duodenal ulcer randomized to receive placebo (n = 76), misoprostol 200 micrograms (n = 77), or misoprostol 300 micrograms (n = 76), q.i.d. orally. Healing of duodenal ulcer was assessed biweekly up to 12 wk by endoscopy, during which procedures at least two antral and two fundal biopsy specimens were taken. The activity and the degree of chronic inflammation of gastritis, as assessed histologically by the infiltration of polymorphs and chronic inflammatory cells, respectively, was graded blindly by two pathologists as nil, mild, moderate, or severe. Before treatment, 99% of patients had chronic antral gastritis and 1.5% had chronic fundal gastritis. In the placebo group, healed duodenal ulcer was associated with significantly (p less than 0.01, life table analysis) higher incidence of improvement of the activity of the antral gastritis (nil or mild as endpoint) than unhealed ulcer (30% vs. 4% at week 8). Irrespective of whether duodenal ulcer was healed or unhealed, significantly (p less than 0.01) more patients on misoprostol (50% at week 8) showed improvement (nil or mild as endpoint) than the placebo group. The degree of chronic inflammation of the antral gastritis showed similar significant changes in favor of misoprostol. Smoking and alcohol intake had no significant effect on the improvement of chronic antral gastritis. In conclusion, healing of duodenal ulcer was associated with improvement of the activity of chronic antral gastritis, which, as shown for the first time, could be further enhanced by a therapeutic agent--prostaglandin E1.
Adult↗
Use of the hepatitis B recombinant DNA yeast vaccine (H-B-VAX II) in children: two doses vs. three doses of 5 micrograms regime; an interim report.
In a prospective randomised trial, children of hepatitis B carriers who were 3 months to 11 years of age and negative for all hepatitis B viral markers were randomised to receive (a) two doses of 5 micrograms of hepatitis B recombinant DNA yeast vaccine (H-B-VAX II) at 0 and 1 month (Group I), (b) three doses of 5 micrograms of H-B-VAX II at 0, 1 and 6 months (Group II) and (c) three doses of 10 micrograms of plasma-derived hepatitis B vaccine (H-B-VAX) (Group III). In the 141 children receiving H-B-VAX II, i.e. in Group I and Group II, side-effects were few and transient. Fever occurred in 10% of the vaccinees. Anti-HBs response rate was 96-100% by 8 months. None of the vaccinees became positive for anti-HBc. The geometric mean of the anti-HBs titre at 8 months was higher for Group II than for Group I (P less than 0.001). The practical and theoretical necessity for this higher titre of anti-HBs in the prevention of future infection by the hepatitis B virus is discussed. Both the two-dose regime and the three-dose regime of 5 micrograms of H-B-VAX II were safe, effective and immunogenic in children.
Child↗
Integration of HBV-DNA may not be a prerequisite for the maintenance of the state of malignant transformation. An analysis of 110 liver biopsies.
Hundred and ten liver biopsy specimens from various parts of the world were examined for episomal and integrated HBV-DNA sequences. In 54 patients with HBsAg chronic liver disease episomal HBV-DNA was found in 83% of HBeAg-positive patients, compared to only 22% of patients with anti-HBe. Furthermore episomal HBV-DNA in the latter predominated among the Asians. Integrated HBV-DNA was found only in 5.5% of HBeAg-positive patients but in 16.5% of patients with anti-HBe. In 28 HBsAg-positive patients with hepatoma, episomal HBV-DNA was found in 50% of HBeAg-positive patients but in only 11% of anti-HBe patients. Conversely integrated sequences were less common (25%) in HBe-Ag-positive patients than in anti-HBe patients (50%), giving an overall incidence of integration in this group of 45%. No episomal, and only one case of integrated sequences of HBV-DNA, could be detected among 10 patients with HBsAg-negative hepatoma. In addition neither episomal nor integrated HBV-DNA could be detected in 18 patients with non-HBV-related liver disease. Our data suggests that stable integration of HBV-DNA into the host's genome is not necessarily a prerequisite for the maintenance of the state of malignant transformation but may be necessary for its initiation. Alternatively, the detection of integrated HBV-DNA may represent a 'snap shot' of a random integration event amplified by clonal expansion promoted by other factors.
Base Sequence↗
Interferon therapy of chronic hepatitis B virus infection in Chinese.
Hepatitis B virus (HBV) infection is prevalent in Chinese populations. 40.4% of 383 Chinese HBV carriers studied were HBeAg-positive. The annual rate of spontaneous clearance of HBeAg was 11%. Twenty-six patients with HBsAg- and HBeAg- and HBeAg-positive non-malignant chronic liver disease randomised to receive recombinant alpha-2 interferon or no treatment have been followed for 6 months or longer. Seven of the 20 treated patients cleared HBeAg during or shortly after treatment but this was sustained in only 1 patient. One of the 6 controls had transient loss of HBeAg. It is too early to conclude whether interferon has any long-term effect on the suppression of HBV replication in Chinese patients. Sixty-nine patients with histologically proven hepatocellular carcinoma were randomised to receive adriamycin or interferon. Although there was no significant benefit on survival, interferon therapy was associated with greater than 25% regression in tumor size in 12.5% of patients and less toxicity.
Carcinoma, Hepatocellular↗
Comparison of the immunogenicity, efficacy and safety of 10 micrograms and 20 micrograms of a hepatitis B vaccine: a prospective randomized trial.
Four thousand and one hospital staff were screened for hepatitis B virus (HBV) markers in a vaccination programme in Hong Kong. The seropositivity rate for HBsAg, anti-HBs and anti-HBc were significantly higher in the 3160 existing hospital staff than in 841 new recruits. Of the subjects negative for HBV markers, 605 were randomized to receive three doses of either 10 or 20 micrograms of the Merck Institute vaccine (HB-VAX). Compared with the 20 micrograms dose, vaccination with the 10 micrograms dose results in equal immunogenicity and efficacy at the completion of the three injections but induced a slower response rate and lower anti-HBs titres with the first two doses. The commonest side-effect of local soreness was less with the 10 micrograms dose. We conclude that (1) hospital staff working in high endemic areas should be vaccinated on recruitment and (2) the 10 micrograms dose of HB-VAX can replace the recommended 20 micrograms dose for adults, being cheaper and as efficacious.
Adolescent↗