Search PubMed⌕ Search

Biomedical subjects

C C Harris

Publications and source records attributed to C C Harris.

At least 37 records · Page 2Linked to original sources
PubMed2001

Perspective: cell differentiation theory may advance early detection of and therapy for lung cancer.

Many of these deaths could be prevented if there were better screening methods to uncover the disease when it is limited and most responsive to intervention. Novel biomarkers of early-stage disease are therefore needed. By applying the principle of "oncology recapitulates ontogeny", we have discovered three homeobox (HOX) genes that are inappropriately expressed in the majority of lung tumors. Understanding the role of these inappropriately expressed genes in lung epithelial cell carcinogenesis may not only augment early detection, but may also offer new avenues of treatment of this disease.

Cell Differentiation↗
PubMed2000

Increased p53 mutation load in nontumorous human liver of wilson disease and hemochromatosis: oxyradical overload diseases.

Hemochromatosis and Wilson disease (WD), characterized by the excess hepatic deposition of iron and copper, respectively, produce oxidative stress and increase the risk of liver cancer. Because the frequency of p53 mutated alleles in nontumorous human tissue may be a biomarker of oxyradical damage and identify individuals at increased cancer risk, we have determined the frequency of p53 mutated alleles in nontumorous liver tissue from WD and hemochromatosis patients. When compared with the liver samples from normal controls, higher frequencies of G:C to T:A transversions at codon 249 (P < 0.001) and C:G to A:T transversions and C:G to T:A transitions at codon 250 (P < 0.001 and P < 0.005) were found in liver tissue from WD cases, and a higher frequency of G:C to T:A transversions at codon 249 (P < 0.05) also was found in liver tissue from hemochromatosis cases. Sixty percent of the WD and 28% of hemochromatosis cases also showed a higher expression of inducible nitric oxide synthase in the liver, which suggests nitric oxide as a source of increased oxidative stress. A high level of etheno-DNA adducts, formed from oxyradical-induced lipid peroxidation, in liver from WD and hemochromatosis patients has been reported previously. Therefore, we exposed a wild-type p53 TK-6 lymphoblastoid cell line to 4-hydroxynonenal, an unsaturated aldehyde involved in lipid peroxidation, and observed an increase in G to T transversions at p53 codon 249 (AGG to AGT). These results are consistent with the hypothesis that the generation of oxygen/nitrogen species and unsaturated aldehydes from iron and copper overload in hemochromatosis and WD causes mutations in the p53 tumor suppressor gene.

Aldehydes↗
PubMed2000

Human mesothelioma samples overexpress both cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (NOS2): in vitro antiproliferative effects of a COX-2 inhibitor.

Accumulating data demonstrate overexpression of both inducible NO synthase (NOS2) and cyclooxygenase-2 (COX2) in many epithelial neoplasias. In addition, cyclooxygenase inhibitors have been shown to have antineoplastic and prophylactic efficacy against human colon cancer and in mouse models of this disease. Mesothelioma arises in a context of asbestos exposure and chronic inflammation, which would be expected to enhance the expression of these inducible enzymes. This study demonstrates that both inducible enzymes were expressed in 30 human mesothelioma tissues but were not detectable in nonreactive mesothelial tissues from the same individuals. In contrast, areas of reactive mesothelial cells stained positively for these enzymes. In vitro exposure of human mesothelioma cell lines to the COX2 inhibitor, NS398, revealed dose- and time-dependent antiproliferative activity, whereas the NOS2 inhibitor, 1400W, had no detectable inhibitory effect. Surprisingly, nonmalignant human mesothelial isolates expressed both NOS2 and COX2 in vitro at the same level as mesothelioma cell lines but were less sensitive to NS398 inhibition. This finding indicates that these nonmalignant isolates may retain properties of reactive mesothelial cells and suggests that targets in addition to COX2 may be involved in the antiproliferative response of mesothelioma cell lines. These results have clinical significance because of the selective activity of the drug coupled with the therapeutic resistance and poor prognosis of mesothelioma. The findings presented here suggest that further preclinical studies of these inhibitors in animal models of mesothelioma would be of great interest.

Adult↗
PubMed2000

Inhibitory effects of nitric oxide and nitrosative stress on dopamine-beta-hydroxylase.

Dopamine-beta-hydroxylase (DbetaH) is a copper-containing enzyme that uses molecular oxygen and ascorbate to catalyze the addition of a hydroxyl group on the beta-carbon of dopamine to form norepinephrine. While norepinephrine causes vasoconstriction following reflex sympathetic stimulation, nitric oxide (NO) formation results in vasodilatation via a guanylyl cyclase-dependent mechanism. In this report, we investigated the relationship between NO and DbetaH enzymatic activity. In the initial in vitro experiments, the activity of purified DbetaH was inhibited by the NO donor, diethylamine/NO (DEA/NO), with an IC(50) of 1 mm. The inclusion of either azide or GSH partially restored DbetaH activity, suggesting the involvement of the reactive nitrogen oxide species, N(2)O(3). Treatment of human neuroblastoma cells (SK-N-MC) with diethylamine/NO decreased cellular DbetaH activity without affecting their growth rate and was augmented by the depletion of intracellular GSH. Co-culture of the SK-N-MC cells with interferon-gamma and lipopolysaccharide-activated macrophages, which release NO, also reduced the DbetaH activity in the neuroblastoma cells. Our results are consistent with the hypothesis that nitrosative stress, mediated by N(2)O(3), can result in the inhibition of norepinephrine biosynthesis and may contribute to the regulation of neurotransmission and vasodilatation.

Adrenal Glands↗
PubMed2000

Increased p53 mutation load in noncancerous colon tissue from ulcerative colitis: a cancer-prone chronic inflammatory disease.

Ulcerative colitis (UC) is a chronic inflammatory disease that produces reactive oxygen and nitrogen species and increases the risk of colorectal cancer (CRC). The p53 tumor suppressor gene is frequently mutated in UC-associated dysplastic lesions and CRC. We are exploring the hypothesis that p53 mutations in the nontumorous colonic tissue in noncancerous UC cases indicate genetic damage from exposure to exogenous and endogenous carcinogens and may identify individuals at increased cancer risk. We are reporting, for the first time, the frequency of specific p53 mutated alleles in nontumorous colon tissue from donors either with or without UC by using a highly sensitive genotypic mutation assay. Higher p53 mutation frequencies of both G:C to A:T transitions at the CpG site of codon 248 and C:G to T:A transitions at codon 247 were observed in colon from UC cases when compared with normal adult controls (P = 0.001 and P = 0.001, respectively). In the UC cases, higher p53 codon 247 and 248 mutation frequencies were observed in the inflamed lesional regions when compared with the nonlesional regions of their colon (P < 0.001 and P = 0.001). The colonic nitric oxide synthase-2 activity was higher in UC cases than in non-UC adult controls (P = 0.02). Our data are consistent with the hypothesis that a higher frequency of p53 mutant cells can be generated under oxidative stress in people with UC. The increased frequency of specific p53 mutated alleles in noncancerous UC colon tissue may confer susceptibility to the development of CRC in an inflammatory microenvironment.

Adult↗
PubMed2000

Identification of four single nucleotide polymorphisms in DNA repair genes: XPA and XPB (ERCC3) in Polish population.

A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance.

Animals↗
PubMed2000

Somatic mutation of the hBUB1 mitotic checkpoint gene in primary lung cancer.

Mutations in mitotic checkpoint genes have been detected in several human cancers, and these cancers exhibit chromosomal instability. Aneuploid stem cells seem to result from chromosomal instability and have been reported in many lung cancers. To determine whether alteration of mitotic checkpoint regulators is involved in carcinogenesis and tumor progression in primary lung cancer, we screened the genomic DNA sequence of 30 human lung cancer cell lines and 30 primary lung cancer tumors for a mutation in the hBUB1 mitotic checkpoint gene. First, we designed 26 sets of intron-based primers to amplify each of the 25 exons of the hBUB1 gene to examine the entire coding region of the hBUB1 gene. Using these primers, we performed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis as well as direct sequencing in the mutation analysis of the hBUB1 gene. Three different nucleotide substitutions were detected in the coding region of the hBUB1 gene in some of the cancer cell lines and primary tumors as follows. The hBUB1 gene of one adenocarcinoma tumor contained a somatic missense mutation, a cytosine-to-guanine substitution in codon 51 of exon 5 that resulted in a histidine-to-aspartic acid amino acid substitution. The hBUB1 gene of three lung cancer cell lines contained a thymine-to-cytosine substitution in codon 430 of exon 12, which did not result in an amino-acid substitution. We were unable to determine whether the nucleotide substitution in exon 12 was a polymorphism or a silent mutation because matched normal tissue was not available. A polymorphism in codon 93 of exon 4, a guanine-to-thymine substitution, in hBUB1 was found in one lung cancer cell line and one primary lung tumor. This is the first report of a somatic missense mutation of a gene involved in a mitotic checkpoint in primary lung cancer. The presence of a point mutation in the hBUB1 gene is consistent with the hypothesis that alteration of mitotic checkpoint genes is involved in the development of primary lung cancers. Because the frequency of hBUB1 gene mutations was low, future studies should focus on other mechanisms of inactivation of the hBUB1 gene as well as mutation analysis of other mitotic checkpoint genes in lung cancers.

Adenocarcinoma↗
PubMed2000

Matrix metalloproteinases and tissue inhibitors of metalloproteinases in bronchial squamous preinvasive lesions.

Metalloproteinases and their inhibitors are known to play an important role in the extracellular matrix remodeling associated with preinvasive lesions and invasive carcinomas; however, little is known about their role in early lung carcinoma. Immunohistochemical studies were made of the reactivity of bronchial squamous preneoplastic lesions from cigarette smokers, including basal cell hyperplasia, squamous metaplasia, dysplasia, carcinoma in situ, and invasive squamous cell carcinoma for matrix metalloproteinases (MMPs), their tissue inhibitors (TIMPs), and type IV collagen in 13 patients. Staining for type IV collagen disclosed discontinuities in basement membranes from basal cell hyperplasia to dysplasia, progressing to destruction in carcinoma in situ and invasive carcinoma. Reactivity for MMP-9 was mild in basal cell hyperplasia and squamous metaplasia, increasing in carcinoma in situ and invasive carcinoma. In contrast, reactivity for MMP-1 was strong in basal cell hyperplasia and squamous metaplasia, decreasing in carcinoma in situ and invasive carcinoma. Some neoplastic cells in carcinoma in situ and invasive carcinoma were MMP-3 positive. Staining for MMP-2 and TIMP-1 was moderate to strong in all squamous preinvasive lesions. Confocal microscopy showed MMP-9-positive cells passing through fragmented basement membranes in which type IV collagen and MMP-9 were colocalized. Type IV collagen colocalized with MMP-2 in all lesions and with TIMP-1 in basal cell hyperplasia and squamous metaplasia. The inverse relationships between the reactivity for MMP-1 and MMP-9 with progression of bronchial squamous preinvasive lesions suggest important roles for these MMPs in basement membrane remodeling in these lesions.

Aged↗
PubMed2000

Molecular epidemiology and carcinogenesis: endogenous and exogenous carcinogens.

Mutations of the p53 tumor suppressor gene are found in about 50% of all human cancers. The p53 mutation spectra in these cancers are providing clues to the etiology and molecular pathogenesis of cancer. Recent studies indicate that the p53 protein is involved in several vital cellular functions, such as gene transcription, DNA synthesis and repair, cell cycle arrest, senescence and programmed cell death. Mutations in the p53 gene can abrogate these functions and may contribute to genomic instability and progression to cancer. Characteristic p53 mutation spectra have been associated with dietary aflatoxin B(1) (AFB(1)) exposure and hepatocellular carcinoma (HCC); sunlight exposure and skin cancer; and cigarette smoking and lung cancer. The mutation spectrum also reveals those p53 mutants that provide cells with a selective clonal expansion advantage during the multistep process of carcinogenesis. Although a number of different exogenous carcinogens have been shown to selectively target p53, pieces of evidence supporting the endogenous insult of p53 are accumulating. Furthermore, analysis of a characteristic p53 mutation load in nontumorous human tissue can indicate previous carcinogen exposure and may identify individuals at an increased cancer risk.

Carcinogens↗
PubMed2000

Carcinogenesis in mouse and human cells: parallels and paradoxes.

It has been known since the last century that genetic changes are important in carcinogenesis [Boveri,T. (1914) Zur Frage der Erstehung Maligner Tumoren. Gustav Fischer, Jena]. Observations of tumor cells growing in tissue culture led to the prediction, even before the true nature of the genetic material was known, that alterations at the chromosomal level were critically involved in the process of neoplastic development. The past 20 years have seen the transition of carcinogenesis studies from the purely observational to the molecular genetic level. Although much more needs to be done, it is nevertheless gratifying to be able to piece together the sequence of events from carcinogen exposure, metabolism of the carcinogen to the activated form, formation of specific carcinogen-DNA adducts, misrepair leading to the fixation of mutations in particular target genes, and the resulting selective outgrowth of neoplastic cells. The nature of many of these steps has been clarified only in the relatively recent past, and only for a small number of specific target genes, but the fact that we can say with confidence that such processes occur and are causal changes in tumorigenesis represents a tremendous advance over the situation pertaining 20 years ago. The purpose of this review is to summarize the advances over this time period in our understanding of some of the genetic alterations that contribute to neoplasia, with particular emphasis on chemical carcinogenesis in rodents and the parallels with transformation of human cells.

Animals↗
PubMed2000

Cancer risk and low-penetrance susceptibility genes in gene-environment interactions.

PURPOSE: To provide a concise review for human cancer risk related to low-penetrance genes and their effects on environmental carcinogen exposure. METHODS: Citation of relevant and recent references for molecular epidemiology, focusing on lung cancer, ethical issues, and some clinical implications of recent molecular epidemiology studies. RESULTS: Low-penetrance genes contribute to cancer risk by augmenting the effects of carcinogen exposures. These exposures can be measured in the body through molecular dosimetry (ie, the amount of DNA damage), which reflects a biologically effective dose. The examination of tumors and the mutations within tumor suppressor genes, such as p53, can provide etiologic clues for both exposure and susceptibility. Although many studies have focused on carcinogen metabolism and cancer risk, more recent studies are considering DNA repair. Also, we are learning that behavior, such as tobacco addiction, also may be genetically controlled. CONCLUSION: Sporadic cancers are caused by gene(n)-environment(n) interactions rather than a dominant effect by a specific gene, environmental exposure, or gene-environment interaction. New paradigms, where we categorize genes as caretaker or gatekeeper genes, will allow for new hypotheses to be tested and will require advanced methods of analysis. The goal of molecular epidemiology is to develop risk assessment models for individuals, but currently the most achievable goal will be population risk assessment and a better understanding of carcinogenesis.

Carcinogens, Environmental↗
PubMed2000

Nitric oxide synthase, cyclooxygenase 2, and vascular endothelial growth factor in the angiogenesis of non-small cell lung carcinoma.

We have investigated the hypothesis that nitric oxide synthase (NOS2), cyclooxygenase-2 (COX2), and vascular endothelial growth factor (VEGF) protein levels individually demonstrate a direct correlation with microvessel density (MVD) and clinical outcome in human non-small cell lung cancer (NSCLC). Furthermore, we hypothesized that MVD may explain the propensity of certain histological lung cancer subtypes for early metastasis via a hematological route. Immunohistochemically, we studied the protein expression levels of NOS2, COX2, and VEGF and MVD by counting CD31-reactive blood vessels (BVs) in 106 surgically resected NSCLC specimens. NOS2, COX2, and VEGF immunoreactivity were observed in 48, 48, and 58%, respectively, of the study subjects, and their levels correlated with MVD at the tumor-stromal interphase (P < or = 0.001). More adenocarcindmas and large cell carcinomas displayed overexpression of NOS2 when compared with squamous cell carcinoma (SCC; r = 0.44; P < 0.001). NOS2 and COX2 levels were found to correlate positively with VEGF status (r = 0.44; P < 0.001, 0.01, and 0.03, respectively). These results attest to the significant interaction of these factors in the angiogenesis of NSCLC. Although neither angiogenic factors nor MVD correlated with patient survival, the latter correlated with tumor clinical stage in both squamous (SCC; 73 BVs/mm2) and non-SCC (78 BVs/mm2) tumors. These results indicate that angiogenesis is a complex process that involves multiple factors including NOS2, COX2, and VEGF. Furthermore, the role of angiogenesis in the biology of various histological lung cancer types may be different. The complexity of angiogenesis may explain the modest results observed in antiangiogenesis therapy that target a single protein.

Carcinoma, Non-Small-Cell Lung↗
PubMed1999

The Werner syndrome gene product co-purifies with the DNA replication complex and interacts with PCNA and topoisomerase I.

Werner syndrome (WS) is a recessive disorder characterized by genomic instability and by the premature onset of a number of age-related diseases. To understand the molecular basis of this disease, we deleted a segment of the murine Wrn gene and created Wrn-deficient embryonic stem (ES) cells. At the molecular level, wild type-but not mutant-WS protein co-purifies through a series of centrifugation, chromatography, and sucrose gradient steps with the well characterized 17 S multiprotein DNA replication complex. Furthermore, wild type WS protein co-immunoprecipitates with a prominent component of the multiprotein replication complex, proliferating cell nuclear antigen (PCNA). In vitro studies also indicate that PCNA binds to a region in the N terminus portion of the WS protein containing a potential 3'-5' exonuclease domain. Finally, human WS protein also co-immunoprecipitates with both PCNA and topoisomerase I. These results suggest that the WS protein interacts with several components of the DNA replication fork.

Animals↗
PubMed1999

Environmental tobacco smoke, genetic susceptibility, and risk of lung cancer in never-smoking women.

BACKGROUND: Exposure to environmental tobacco smoke (ETS) is considered to be a major lung cancer risk factor for never smokers. We investigated the hypothesis that never-smoking women who are exposed to ETS and develop lung cancer are a genetically susceptible population. METHODS: Archival tumor tissues were analyzed from 106 never-smoking women enrolled in a case-control study of ETS (and other personal and environmental factors) and lung cancer risk. We analyzed germline polymorphisms in genes that have been associated with cancer susceptibility and whose products activate (cytochrome P450 1A1 [CYP1A1]) and detoxify (glutathione S-transferases M1 [GSTM1] and T1 [GSTT1]) chemical carcinogens found in tobacco smoke. RESULTS: When compared with never smokers who had no ETS exposure and developed lung cancer (n = 55), never smokers with exposure to ETS who developed lung cancer (n = 51) were more likely to be deficient in GSTM1 activity (i.e., were GSTM1 null) because of a genetic polymorphism in the GSTM1 gene (odds ratio = 2.6; 95% confidence interval = 1.1-6.1). A statistically significant rising trend in risk occurred with increasing ETS exposure (two-sided P =. 02), reaching a more than sixfold excess risk in those exposed to 55 pack-years of ETS (ETS pack-year = ETS produced by an active smoker, within a confined space such as a room, who smokes one pack of cigarettes a day for a year). No evidence was found of associations between GSTT1 deficiency or the CYP1A1 valine variant and lung cancer risk due to ETS exposure. CONCLUSIONS: A common genetic polymorphism divides the population of never smokers into two groups of approximately equal size, one (homozygous carriers of the GSTM1 null allele) that has a statistically significant greater risk of lung cancer from ETS than the other (heterozygous or homozygous carriers of the wild-type GSTM1 allele).

Adult↗
PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗
PubMed1999

Preferential binding of tumor suppressor p53 to positively or negatively supercoiled DNA involves the C-terminal domain.

The C-terminal domain of the tumor suppressor protein p53 is the site of non-specific DNA binding. Purified p53 produced from baculovirus-infected insect cells binds preferentially to supercoiled DNA, forming bands with lower electrophoretic mobility. This non-covalent binding does not change the linking number of the DNA. An anti-p53 antibody targeting the C-terminal domain partially competes with supercoiled DNA in binding to p53, while antibodies targeted to the N terminus of p53 supershift the complex bands. A synthetic peptide corresponding to amino acid residues 319-393 of human p53 also displays preferential binding to supercoiled DNA, while a mutant peptide, which is unable to form tetramers, is inactive. The center of the equilibrium distribution of topoisomers formed by relaxation with topoisomerase I is not shifted in the presence of p53 although the distribution is broadened. The preferential binding of p53 is exhibited toward both positively and negatively supercoiled DNA. These observations are consistent with a model in which p53 binds to right-handed or left-handed strand crossings.

Antibodies↗