Purification of nucleic acids by filtration through a hydrophobic membrane.
Explore the source record for details and available documents.
Filtration↗
Biomedical subjects
C B Harley
Publications and source records attributed to C B Harley.
Deproteination of nucleic acids by filtration through a hydrophobic membrane.
To remove or inactivate an enzyme from DNA in multistep procedures in molecular biology, it is often necessary to phenol extract the solution, followed by chloroform extraction and ethanol precipitation. In addition to being time-consuming and hazardous, there can be significant loss of DNA with this procedure, especially when small volumes or amounts of DNA are being used. We have found that filtering analytical reaction mixtures through a hydrophobic membrane specifically to remove protein is a rapid alternative to phenol extraction. Within broad limits commonly encountered in molecular biology, filtration through a polyvinylidene difluoride membrane quantitatively removes a variety of enzymes without significant loss of double-stranded nucleic acid.
Alkaline Phosphatase↗
Fetal bovine serum contains an inhibitor of interleukin-1.
The keratinocyte cell line COLO-16 constitutively produces factors with interleukin-1 (IL-1) activity including IL-1 alpha and IL-1 beta. IL-1 activity assayed by thymocyte proliferation from cell supernatants was 20-50% less if cells were maintained in media containing 10% fetal bovine serum (FBS) compared to media without serum 24 h prior to harvest. The increased IL-1 activity in supernatants from cells in serum free media was not due to increased cellular levels of IL-1 alpha or IL-1 beta mRNA. Similarly, IL-1 activity recovered from conditioned supernatants of COS cells transfected with expression vectors containing IL-1 beta cDNA was approximately 22-45% less in cells grown in 20% FBS medium compared to similar cultures grown for 3 days post transfection in 1% FBS. When serial dilutions of recombinant IL-1 were made in buffer containing 10% FBS and assayed by a thymocyte proliferation method, a 30-50% decrease in activity was observed. IL-1 activity was also measured by its ability to induce prostaglandin E2 synthesis by fibroblasts. When COS conditioned supernatants were applied to fibroblast cultures there was 30% less prostaglandin E2 activity from fibroblasts treated with COS supernatants containing 20% FBS, compared to supernatants containing 1% FBS. The inhibitor molecule was partially purified by gel filtration and found to have a molecular weight of approximately 85,000. The presence of FBS in cell-conditioned media significantly reduces the sensitivity of IL-1 detection by bioassay techniques.
Animals↗
Telomeres shorten during ageing of human fibroblasts.
The terminus of a DNA helix has been called its Achilles' heel. Thus to prevent possible incomplete replication and instability of the termini of linear DNA, eukaryotic chromosomes end in characteristic repetitive DNA sequences within specialized structures called telomeres. In immortal cells, loss of telomeric DNA due to degradation or incomplete replication is apparently balanced by telomere elongation, which may involve de novo synthesis of additional repeats by novel DNA polymerase called telomerase. Such a polymerase has been recently detected in HeLa cells. It has been proposed that the finite doubling capacity of normal mammalian cells is due to a loss of telomeric DNA and eventual deletion of essential sequences. In yeast, the est1 mutation causes gradual loss of telomeric DNA and eventual cell death mimicking senescence in higher eukaryotic cells. Here, we show that the amount and length of telomeric DNA in human fibroblasts does in fact decrease as a function of serial passage during ageing in vitro and possibly in vivo. It is not known whether this loss of DNA has a causal role in senescence.
Aging↗
Reiterative copying by E.coli RNA polymerase during transcription initiation of mutant pBR322 tet promoters.
The major in vitro transcripts from the tet promoter of pBR322 derivatives pTA22 and pTA33 have heterogeneous 5' ends consisting of variable lengths of oligo(A). Their structure is 5'pppAnU..., where n ranges from 1 to greater than 12, but the template strand can encode at most four A residues at the site of transcription initiation. The abundance of additional A residues at the 5' end of the pTA22 and pTA33 tet transcripts could be reduced by elevating the concentration of UTP, but even at high concentrations (greater than 1 mM) non-cognate A residues were still observed. Aberrant initiation was not artifactual since the major and minor transcripts of the pBR322 tet promoter region, and other transcripts arising from minor promoters on pTA22 or pTA33 DNA all had unique 5' termini. Mixing experiments showed that RNA polymerase did not utilize pppA2-4-OH produced by abortive initiation as primers. The data suggest that the initial nascent RNA chain 'slips' in the 5' direction during elongation opposite T4 on the template strand causing RNA polymerase to reiteratively add A residues to the 5' end of the transcript. The generality and possible significance of this mechanism is discussed.
Base Sequence↗
Expression of interleukin-1 beta in a human keratinocyte cell line.
The human keratinocyte cell line COLO-16 expresses mRNA homologous to human IL-1 alpha and IL-beta (transcript sizes 2.3 and 1.6 kb, respectively). A 1.2 kbp cDNA was selected with a human IL-1 beta probe from a lambda gt11 library constructed using poly A+ RNA from COLO-16 cells. Sequence analysis revealed that this cDNA was nearly identical to the 3' 1.2 kb of human monocyte IL-1 beta. When this cDNA was expressed in COS cells using a mammalian expression vector, IL-1 activity was detected in the cell conditioned supernatants using assays for D10-T-cell, thymocyte and fibroblast proliferation. Western analysis of lysates from COS cells transfected with this clone revealed the presence of a -17 kDa protein which reacted with antisera to human IL-1 beta. This protein was the same size as the processed form of IL-1 beta present in COLO-16 cells suggesting that this cDNA encodes the mature form of IL-1 beta. COLO-16 cells contain proteins of -30 kDa and 17 kDa which are immunoreactive with specific antisera for human IL-1 alpha and human IL-1 beta. Despite the presence of four-fold greater amounts of immunoreactive IL-1 beta protein than IL-1 alpha in cell lysates, all the IL-1 activity in the lysate could be neutralized by antisera to IL-1 alpha. IL-1 beta comprised only 25% of the IL-1 activity in the cell-conditioned media, all remaining activity was neutralized by antisera to IL-1 alpha. Whereas IL-1 alpha protein in both cell lysates and conditioned supernatants was predominantly in the processed -17 kDa form, IL-1 beta proteins were primarily of the processed and inactive 30kDa species. This apparent inability of keratinocytes to process IL-1 beta may explain our observations that the IL-1 activity secreted by COLO-16 cells is principally due to IL-1 alpha.
Amino Acid Sequence↗
Metallothionein mRNA and protein induction by cadmium in peripheral-blood leucocytes.
To help to evaluate the role of metallothionein (MT) in peripheral-blood leucocytes, we examined MT protein and mRNA levels in these cells before and after exposure to CdCl2 in culture. Protein was assayed by 109Cd2+ binding, and RNA by dot-blot hybridization. MT was induced in both lymphocytes and adherent monocytes about 10-fold with a 12 h exposure to 10 microM-CdCl2, but absolute levels were 3-fold higher in monocytes: 57 x 10(5) (+Cd2+) versus 6 x 10(5) (-Cd2+) molecules/cell for monocytes; 18 x 10(5) (+Cd2+) versus 2 x 10(5) (-Cd2+) for lymphocytes. Polymorphonuclear cells expressed relatively little MT (0.6 x 10(5) molecules/cell), and this did not change with phorbol ester stimulation or exposure to Cd2+, arguing against a direct protective role for MT in activated neutrophils. MT mRNA levels corresponded qualitatively to expression of protein in these cells. Our data provide quantitative comparisons of leucocyte MT expression and regulation in the human population. Variation in both basal and induced MT mRNA levels reflects environmental or experimental (intra-individual) and possibly genetic (inter-individual) differences.
Cadmium↗
Molecular analysis of pleckstrin: the major protein kinase C substrate of platelets.
Activation of protein kinase C (PKC) in platelets causes the immediate phosphorylation of pleckstrin, an apparent Mr 40-47,000 protein previously called 40K or P47. Pleckstrin presumably plays an important but as yet unknown role in mediating cellular responses evoked by agonist-induced phosphoinositide turnover. We have cloned the cDNA for pleckstrin from the HL-60 human promyelocytic leukemia cell line by immunological screening of a lambda gt11 expression library (Tyers et al.: Nature 333:470-473, 1988) and now report further analysis of the pleckstrin sequence. Pleckstrin has a deduced Mr of 40,087 and is encoded by a 1,050-bp open reading frame which is preceded by a short open reading frame that terminates before the correct initiator methionine. A single polymorphic site was found in the coding region. An unusual pattern of sequence heterogeneity occurred about a poly(A) tract in the 3' untranslated region. The 3.0-kb pleckstrin mRNA induced upon differentiation of HL-60 cells apparently has heterogeneous 5' ends which undergo differential regulation during HL-60 cell maturation. Analysis by multiple sequence alignment with known PKC substrates identified a strong candidate site for phosphorylation by PKC and a potential Ca2+-binding EF-hand motif. No other similarities to proteins in current databases were found.
Amino Acid Sequence↗
Primary structure of a human mitochondrial protein homologous to the bacterial and plant chaperonins and to the 65-kilodalton mycobacterial antigen.
The complete cDNA for a human mitochondrial protein designated P1, which was previously identified as a microtubule-related protein, has been cloned and sequenced. The deduced amino acid sequence of P1 shows strong homology (40 to 50% identical residues and an additional 20% conservative replacements) to the 65-kilodalton major antigen of mycobacteria, to the GroEL protein of Escherichia coli, and to the ribulose 1,5-bisphosphate carboxylase-oxygenase (rubisco) subunit binding protein of plant chloroplasts. Similar to the case with the latter two proteins, which have been shown to act as chaperonins in the posttranslational assembly of oligomeric protein structures, it is suggested that P1 may play a similar role in mammalian cells. The observed high degree of homology between human P1 and mycobacterial antigen also suggests the possible involvement of this protein in certain autoimmune diseases.
Amino Acid Sequence↗
Metallothionein RNA levels in HL-60 cells. Effect of cadmium, differentiation, and protein kinase C activation.
Metallothionein (MT) gene transcription is regulated in a developmental and tissue-specific manner by metal ions and other agents. We examined MT expression in the human promyelocytic leukemia cell line HL-60 during differentiation along macrophage and neutrophil lineages. All HL-60 phenotypes showed similar basal levels of MT RNA with significant induction following exposure to Cd2+ but not activators of PKC. MT RNA did not correlate with growth state or with known levels of PKC activity, thus our data do not support a role for MT in HL-60 differentiation or for PKC in MT expression.
Amino Acid Sequence↗
Transcription initiation at the tet promoter and effect of mutations.
We have identified the startpoint for transcription in vitro of the tetracycline resistance gene (tet) of pBR322 and several deletion and insertion mutations which alter tet promoter structure. Tetracycline resistance in host bacteria correlates qualitatively with the efficiency of DNA fragments from these plasmids to promote tet transcription in vitro. Only in active promoters could we find by computer analysis promoter structures in which the -10 and -35 sequences and the relative spacing of the two regions agree with consensus sequence determinants. These data support the current model of the E. coli promoter sequence. Two promoter mutants gave heterogeneous 5' termini with additional A residues not encoded by the DNA sequence.
Base Sequence↗
Molecular cloning and expression of the major protein kinase C substrate of platelets.
In platelets, agonists that stimulate phosphoinositide turnover cause the rapid phosphorylation of a protein of apparent relative molecular mass (Mr) 40-47,000, called P47, by protein kinase C (PKC). Diverse identities have been ascribed to P47 including lipocortin, inositol 1,4,5-trisphosphate 5-phosphomonoesterase, pyruvate dehydrogenase alpha subunit and an actin regulatory protein. We have isolated human P47 clones by immunological screening of a lambda gt11 complementary DNA library from HL-60 cells, a human promyelocytic leukaemia cell line. P47 recombinants thus identified hybridized to a 3.0 kilobase (kb) messenger RNA in mature white blood cell lines; the same mRNA was induced in HL-60 cells during differentiation. A 1,050 base pair (bp) open reading frame that could encode a protein of Mr40,087 was confirmed by comparison with peptide sequences from platelet P47, and by expression of the putative recombinant P47 in E. coli and in vitro. The P47 sequence appears to have been conserved throughout vertebrate evolution, and is not similar to any other known sequence including human lipocortin and the alpha subunit of pyruvate dehydrogenase. The P47 protein contains a potential Ca2+-binding 'EF-hand' structure and a region that strongly resembles known PKC phosphorylation sites.
Amino Acid Sequence↗
Effect of vitamin E on lifespan and reproduction in Caenorhabditis elegans.
Vitamin E extends the lifespan of many animals, including the nematode Caenorhabditis elegans. Our results confirm previous studies that 200 micrograms/ml vitamin E significantly prolonged C. elegans survival (17-23%, P less than 0.05) when added from hatching to day 3, while continuous exposure, either at hatching or from 4 days prior to hatching, had little additional effect. Treatment with 100 or 400 micrograms/ml vitamin E, or with other antioxidants (80 micrograms/ml vitamin C, either alone or in combination with vitamin E, or 120 micrograms/ml N,N'-diphenyl-1,4-diphenylenediamine (DPPD] did not significantly affect lifespan. All treatments with 200 micrograms/ml vitamin E moderately reduced fecundity (total progeny) and increased the mean day of reproduction. At 400 micrograms/ml, vitamin E had severe effects, while DPPD, vitamin C, and 100 micrograms/ml vitamin E had slight effects on both these parameters of reproduction. These data suggest that vitamin E increases lifespan in C. elegans in part by slowing development in the same manner that metabolic-depressant or mildly cytotoxic drugs increase lifespan, decrease fecundity, and delay the timing of reproduction.
Animals↗
In situ detection of interleukin-1 mRNA in human monocytes.
The interleukin-1 (IL-1) family of soluble pleiotropic immunoregulatory and proinflammatory peptides has at least two distinct members, alpha IL-1 and beta IL-1. Since beta IL-1 is the predominant species in human monocytes, this study was undertaken to identify its mRNA in monocytes using in situ hybridization with a 35S-dCTP labelled beta IL-1 cDNA probe. Grain count analysis demonstrated that adherent lipopolysaccharide-stimulated monocytes were positive, while unstimulated monocytes, lymphocytes and neutrophils, and cells probed with vector only (35S-labelled pBR322) were all negative. We have also shown that in situ hybridization is approx. 13-fold more sensitive than conventional hybridization and in addition this technique allows visualization of mRNA coding for IL-1 in individual cells with morphology preserved. We conclude that in situ hybridization is a specific and sensitive technique for the detection of beta IL-1 mRNA in individual human peripheral blood monocytes.
Autoradiography↗
Normalization of RNA dot blots with oligo(dT).
Explore the source record for details and available documents.
Immunoblotting↗
Biology and molecular biology of epidermal cell-derived thymocyte activating factor.
ETAF/IL-1 has a multiplicity of divergent biological effects: enhancement of thymocyte proliferation, stimulation of cells in the hypothalamus to mediate fever, leukocyte chemotaxis, stimulation of hepatic synthesis of acute-phase proteins, augmentation of IL-2 production and keratinocyte proliferation. Until recently, it has not been possible to determine whether these divergent activities are mediated by closely related cytokines or separate cytokines. Now with the identification of IL-1 alpha, IL-1 beta and IL-1k from keratinocytes, these studies will become possible. In either case, it is likely that ETAF/IL-1 plays an important role in local cutaneous and systemic inflammatory and immunological events.
Animals↗
Generation and statistical mechanical modeling of Z-DNA in the mouse metallothionein I promoter.
The mouse metallothionein I promoter has a potential Z-DNA sequence 86-102 bases upstream from the transcription start. The alternating purine/pyrimidine nature of this sequence, d-(GCGCGTGACTATGCGTG), is interrupted by a central d(AC) dinucleotide. We reversed the d(AC) to d(CA) by site-directed mutagenesis and subcloned the wild-type and mutated 218 base pair (bp) SstI-BglII fragment containing this region into pUC12. By two-dimensional chloroquine gel analysis, the mutant promoter clearly underwent a B-Z transition with a resulting loss of at least five twists. Purines within this sequence exhibited diethyl pyrocarbonate (DEP) sensitivity, which extended in both the 5' and 3' direction encompassing a region of approximately 32 base pairs. When subjected to sufficient torsional stress, the wild-type sequence showed weak evidence of a transition on chloroquine gels and clear DEP sensitivity with a similar, yet distinct pattern. Statistical mechanical modeling of the chloroquine gel analysis demonstrated that the average free energy of propagation for the mutant sequence (0.7-0.9 kcal mol-1 bp-1) was approximately twice that for d(CG)n sequences and that the sequence d(GACGCGGGGCGCGTGCATATGCGTGG) forms the core Z-DNA region.
Animals↗
Induction of the 47 kDa platelet substrate of protein kinase C during differentiation of HL-60 cells.
Immunoblot analysis showed that the 47 kDa platelet substrate of protein kinase C (P47) was expressed at low levels in undifferentiated HL-60 leukaemia cells. Treatment of these cells with dimethyl sulphoxide, 1 alpha,25-dihydroxycholecalciferol or retinoic acid caused progressive increases in P47 content. Retinoic acid (1 microM) elicited the largest response, a 4-fold increase in P47 protein after 7 days that was accompanied by an increase in translatable P47 mRNA. The induction of P47 by retinoic acid preceded cessation of cell proliferation and development of the capacity to reduce Nitro Blue Tetrazolium, indicating that its expression is an early event in the myeloid differentiation of HL-60 cells.
Blood Proteins↗