Search PubMedSearch

Biomedical subjects

B Thomsen

Publications and source records attributed to B Thomsen.

17 recordsLinked to original sources

Histone hyperacetylation is accompanied by changes in DNA topology in vivo.

The effect of histone acetylation on the topology of plasmids transfected into COS7 cells was examined. Parallel determinations of histone profiles and DNA topology showed that with increasing levels of acetylation the minichromosomal DNA is gradually relaxed. This effect could not be attributed to the increased transcriptional activity accompanying butyrate treatment since plasmids with different promoter strengths exhibited similar superhelical densities. Considering that the number of nucleosomes/minichromosome were constant under these conditions, the data suggest that in vivo histone hyperacetylation reduces the linking number change/nucleosome.

Acetylation

Stimulation of topoisomerase II mediated DNA cleavage at specific sequence elements by the 2-nitroimidazole Ro 15-0216.

The effect of the 2-nitroimidazole Ro 15-0216 upon the interaction between purified topoisomerase II and its DNA substrate was investigated. The cleavage reaction in the presence of this DNA-nonintercalative drug took place with the hallmarks of a regular topoisomerase II mediated cleavage reaction, including covalent linkage of the enzyme to the cleaved DNA. In the presence of Ro 15-0216, topoisomerase II mediated cleavage was extensively stimulated at major cleavage sites of which only one existed in the 4363 base pair pBR322 molecule. The sites stimulated by Ro 15-0216 shared a pronounced sequence homology, indicating that a specific nucleotide sequence is crucial for the action of this drug. The effect of Ro 15-0216 thus differs from that of the clinically important topoisomerase II targeted agents such as mAMSA, VM26, and VP16, which enhance enzyme-mediated cleavage at a multiple number of sites. In contrast to the previous described drugs, Ro 15-0216 did not exert any inhibitory effect on the enzyme's catalytic activity. This observation might be ascribed to the low stability of the cleavage complexes formed in the presence of Ro 15-0216 as compared to the stability of the ones formed in the presence of traditional topoisomerase II targeted drugs.

Acetanilides

Characterization of the interaction between topoisomerase II and DNA by transcriptional footprinting.

The interaction between calf thymus topoisomerase II and DNA has been characterized using a transcription assay. A highly preferred recognition sequence for topoisomerase II was inserted in either direction downstream from a promoter specific for a bacteriophage RNA polymerase. The presence of topoisomerase II-DNA complexes on the template provoked blockage of transcription, yielding RNA transcripts terminated 5' to the topoisomerase II binding site. A footprint of topoisomerase II, derived from transcription towards the complex from either side, revealed that eukaryotic topoisomerase II binds a region of 28 base-pairs with a highly protected central core of 22 base-pairs. The binding region was located symmetrically around the topoisomerase II-mediated cleavage site. In agreement with this result, optimal topoisomerase II-mediated cleavage was observed with a DNA substrate consisting of a 28-mer oligonucleotide homologous to the protected region. Stepwise removal of base-pairs from the ends of the 28-mer gradually reduced the level of enzyme-mediated cleavage.

Acetanilides

Camptothecin-stabilized topoisomerase I-DNA adducts cause premature termination of transcription.

The antitumor agent camptothecin stabilizes type I topoisomerase-DNA complexes. One of the primary cellular responses to camptothecin exposure is rapid cessation of RNA synthesis. Results obtained by using an in vitro transcription system supplemented with eukaryotic topoisomerase I show that this inhibition can be attributed to physical blockage of the RNA polymerase by camptothecin-stabilized topoisomerase I-DNA complexes on the DNA template. The site of premature termination is located 10 base pairs upstream of the topoisomerase I linked nucleotide residue on the coding strand, corresponding closely to the border of the protected area obtained in a micrococcus nuclease footprint of topoisomerase I. The RNA polymerase transcribes unimpeded through complexes attached to the noncoding strand. No inhibitory effect of camptothecin on RNA transcription was observed with human topoisomerase I isolated from a camptothecin-resistant cell line. Taken together, the data suggest that part of the cytotoxicity of camptothecin is mediated through adduct formation on transcribed DNA, resulting in interference with transcriptional elongation.

Base Sequence

The chloride shift may facilitate oxygen loading and unloading to/from the hemoglobin from the brown bear (Ursus arctos L.).

1. The oxygen binding properties of hemolyzed bear blood were studied in 0.1 M Tris and 0.1 M Hepes buffer with respect to the possible effects of temperature, pH, pCO2, 2,3-DPG, and chloride ions. 2. There was a significant Bohr shift with a Bohr factor (delta log P50/delta pH) of the magnitude of -0.5. The temperature sensitivity expressed by the apparent heat of oxygenation minus the heat of oxygen in solution was about -8.1 kcal/mol at pH 7.4. 3. Chloride ions decreased the oxygen affinity in the concentration range 50-200 mM, and there was a marked increase in the co-operativity of oxygenation up to a chloride concentration of about 200 mM. 4. There were no effects of pCO2 and 2,3-DPG in the presence of 200 mM Cl-, while in the absence of Cl-, 2,3-DPG had the same effect as 200 mM Cl- at 37 degrees C and pH 7.4. 5. Our results suggests at least two different binding sites for the chloride ion, one high affinity site which may also bind 2,3-DPG in the absence of chloride, and one or more low affinity sites, which only binds chloride. 6. The results further show, that a chloride shift of about 33 mM may account for as much as a 40% increase in O2 unloading, without taking into account the additional effect of the Bohr shift.

2,3-Diphosphoglycerate

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage.

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.

Base Sequence

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Animals

Humoral autoimmune manifestation in subacute thyroiditis.

To study the autoimmune manifestations in subacute thyroiditis (SAT), the patterns of thyroid antibodies, thyroglobulin and circulating immune complexes were investigated in 10 patients during the course of the disease. Eight patients were thyrotoxic at diagnosis, and became euthyroid during recovery with a median observation of 8 months (4-30 months). Thyroid stimulating immunoglobulins were measured as TSH binding inhibiting immunoglobulins (TBII) and as thyroid stimulating antibodies (TSAb). TBII were present in all patients at least once during the observation period and remained detectable in six patients after recovery. TSAb were detected in three patients without relation to the hyperthyroid state. Thyroglobulin antibodies (TgAb) were present in four patients and persisted in three, while microsomal antibodies (MAb) were negative. Thyroglobulin (Tg) in the TgAb negative patients (n = 6) was high at diagnosis (median 229 micrograms/l, range 55-375) and fell rapidly during the course of SAT. Circulating immune complexes (CIC), which were found in all patients, reached maximal levels shortly after the onset of the disease and persisted after recovery. No correlation could be demonstrated between the different thyroid antibodies, and there was no clear relation between the levels of CIC and presence of the autoantibodies. However, the changes in CIC paralleled the changes in TBII, and it is suggested that immune complex formation is a major feature of the regulatory mechanisms controlling the immune responses in SAT.

Adult

Plasma separation in patients with bronchial asthma, atopic dermatitis and hyperimmunoglobulinaemia E.

The effect of intensive plasma separation performed eight times within 5 weeks in four patients with atopic dermatitis, bronchial asthma and hyperimmunoglobulinaemia E was followed as regards clinical symptoms and changes in the concentrations of serum (S) IgE, S IgG, S IgA, S IgM, plasma complement C3 split products, S transferrin, blood eosinophils, chemotaxis of neutrophil cells and histamine metabolites in urine in samples obtained consecutively during the period of observation. The occurrence of circulating immune complexes (IC) was analysed by a polyclonal rheumatoid factor (pRF) agglutination inhibition assay and an IgE IC specific technique. IgE IC were demonstrated in three of the patients prior to plasma separation, complexed IgE was 2-3% of the total concentration of S IgE. In one patient complexes were detected by the pRF agglutination inhibition assay, also. In the three patients with IgE IC, the complexes disappeared during treatment, but recurred in two of the patients shortly after the last plasma separation. Shortly after eight separations the S IgE was reduced in all patients to a mean level of 46% of the pre-exchange concentrations. During the following 3 weeks the relative increase of S IgE in three of the patients was similar to the values obtained for S IgG. Serum IgG was subnormal in all patients during the period of treatment. Increasing numbers of eosinophils were observed in three of the patients after the fifth separation procedure. The histamine metabolite 1,4-methylimidazoleacetic (1,4- MIAA ) in urine was increased in all patients, but no significant changes were observed during the treatment.(ABSTRACT TRUNCATED AT 250 WORDS)

Adult

Molecular biology of Haemophilus influenzae IgA1 proteases.

IgA1 proteases of two distinct specificities were demonstrated among 95 isolates of Haemophilus influenzae and nine isolates of H. aegyptius. The two enzymes cleaved two different peptide bonds in the hinge region of the alpha chain of IgA1: a prolyl-seryl bond located at position 231-232 (type A cleavage) and a prolyl-threonyl peptide bond between residues 235 and 236 (type B cleavage). Each strain of H. influenzae produced either one or both of these types of enzymes, whereas all H. aegyptius strains produced type A enzyme only. The application of enzyme-neutralizing antibodies to the study of IgA1 proteases produced by the 104 strains of H. influenzae and H. aegyptius revealed at least 15 different types of protease activities based on inhibition patterns in nine selected antibody preparations. The types of IgA1 proteases closely correlated with the serotype of encapsulated strains of H. influenzae. The study suggests that H. influenzae strains produce at least two serologically different IgA1 proteases with distinct or identical enzymatic activities.

Amino Acid Sequence

Antigenic heterogeneity of immunoglobulin A1 proteases from encapsulated and non-encapsulated Haemophilus influenzae.

Indirect evidence suggests that immunoglobulin A1 (IgA1) proteases may be factors in the pathogenesis of certain infectious diseases, including meningitis, gonorrhoea, and destructive periodontitis. Bacterial IgA1 proteases are therefore potential candidates as vaccines. In this study, IgA1 proteases from 166 clinical isolates and reference strains of Haemophilus influenzae and Haemophilus aegyptius were compared with regard to specific activity and pattern of enzyme inhibition by antisera raised against IgA1 protease from nine selected strains of H. influenzae. A total of 93% of H. influenzae strains and all H. aegyptius strains had detectable IgA1 protease activity. The majority of strains cleaved a prolyl-seryl or a prolyl-threonyl peptide bond in the alpha 1 hinge region, whereas occasional H. influenzae strains possessed two separate IgA1 proteases with these two specific activities. Of the 155 IgA1 protease-producing strains, all except 12 could be assigned to one of 14 IgA1 protease "inhibition types," each defined by a characteristic pattern of inhibition by the nine antisera. There was no correlation between IgA1 protease type and biotype of the strains. However, among 92 encapsulated H. influenzae strains, a close correlation between capsular serotype and IgA1 protease type was observed. With the exception of serotype f, strains of all capsular serotypes produced an exclusive antigenic type of IgA1 protease. All 38 strains of serotype b produced IgA1 protease of inhibition type 1, which was never demonstrated in non-encapsulated H. influenzae strains. These results facilitate the detection of an antibody response against specific IgA1 proteases and are of practical value for a possible future vaccine against H. influenzae serotype b infections.

Antigens, Bacterial

Ischaemic heart disease in middle-aged men. Prevalence comparisons in Europe.

The authors report the results of a collaborative study of the prevalence of ischaemic heart disease in 6 samples of middle-aged male clerical workers, drawn from 5 European countries and covering in all 4522 subjects. Detailed standardization of data-collection methods and of coding, analysis and tabulation was undertaken.Estimated prevalence rates for angina and history of possible infarction, based on the use of a standard questionnaire, showed significant variation between samples, but the validity of international comparisons of symptoms remains unproven. Prevalence rates for ischaemic-type ECG findings were high everywhere, and mostly showed no significant variation between the groups studied. Central coding of ECG findings proved essential to the making of unbiased comparisons. Neither the prevalence rates for symptoms nor those for ECG findings in these samples were recognizably correlated with the corresponding national mortality rates for ischaemic heart disease.Several possible risk factors were studied, but the only one found to be consistently associated with ischaemic heart disease was a raised blood pressure. Cigarette smoking was strongly associated with bronchitic symptoms and dyspnoea, but an association with heart disease was not demonstrated.

Blood Pressure

Preferential relaxation of supercoiled DNA containing a hexadecameric recognition sequence for topoisomerase I.

In prokaryotes, the degree of supercoiling of DNA can profoundly influence the use of specific promoters. In eukaryotes, a variety of indirect observations suggest that DNA topology has a similar importance in proper gene expression. Much attention has therefore been focused on the cellular proteins that control DNA supercoiling, among which are the enzymes topoisomerase I and II. A hexadecameric sequence functions as a strong attraction site for topoisomerase I. Here we report that the interaction of topoisomerase I with this sequence motif is highly specific, because a single base-pair substitution prevents strand cleavage and thereby catalytic activity at the sequence. Thus, supercoiled DNA containing the recognition sequence is relaxed preferentially by topoisomerase I compared to a control, but no difference in the relaxation rate is observed for supercoiled DNA carrying the mutated sequence. The preference for the recognition sequence seems to be an intrinsic property of all eukaryotic type I topoisomerases, suggesting that the interaction might be important in a fundamental biological process.

Base Composition