Search PubMed⌕ Search

Biomedical subjects

B Moss

Publications and source records attributed to B Moss.

At least 289 records · Page 16Linked to original sources

Large-scale production and purification of a vaccinia recombinant-derived HIV-1 gp160 and analysis of its immunogenicity.

The human immunodeficiency virus (HIV-1) envelope gene was expressed in large-scale microcarrier cultures of Vero cells using a system involving coinfection with two recombinant vaccinia viruses. One recombinant contained the bacteriophage T7 RNA polymerase gene under control of a vaccinia virus promoter. The second contained the HIV-1 gp160 gene flanked by T7 promoter and termination sequences. The protein was expressed on the surface of infected cells, and it was shown to have a molecular weight of 160 kD and to react with gp41 and gp120 specific monoclonal antibodies. After purification by successive affinity and ion-exchange chromatography, the protein was demonstrated to be present in a particulate form with a diameter in the range of 15-30 nm. When injected into goats a high-titer gp160 specific antibody response was elicited and group-specific neutralizing activity could be demonstrated in vitro. The immunogenicity of the protein was also studied in conjunction with a number of adjuvant formulations, and the highest potency in mice was obtained using a preparation with 0.2% Al(OH)3 and 0.25% deoxycholate.

Adjuvants, Immunologic↗

Isolate- and group-specific immune responses to the envelope protein of human immunodeficiency virus induced by a live recombinant vaccinia virus in macaques.

The immune responses produced by four macaques inoculated intradermally with a recombinant vaccinia virus that expresses the envelope gene of human immunodeficiency virus (HIV) were analyzed. Antibody capable of immunoprecipitating the glycosylated envelope protein precursor gp160 was detected in all animals within 3 weeks after the primary intradermal vaccination. The level of antibody was increased following a booster inoculation, and the sera from three of the four animals were then capable of immunoprecipitating gp120. Sera from two of the macaques with anti-gp120 antibody were able to prevent syncytium formation mediated by the parent HIV but not that induced by an unrelated HIV isolate. The fusion-inhibiting antibody was directed toward the highly variable central portion of the gp120 molecule since the effect was abrogated by incubation with PB1. The latter is a recombinant protein produced in Escherichia coli containing amino acids 295-474, a major neutralizing epitope. Sera from the three macaques with anti-gp120 neutralized HIV infectivity in an isolate-specific manner. The serum with highest neutralizing activity was also best at inhibiting syncytium formation. In contrast to the isolate-specific nature of the neutralizing antibody, T lymphocytes from immunized animals proliferated in response to divergent HIV isolates as well as to purified gp120. These studies provide baseline immunologic information for further development of recombinant vaccinia virus vectors.

Animals↗

Capped poly(A) leaders of variable lengths at the 5' ends of vaccinia virus late mRNAs.

Evidence for capped poly(A) leaders of variable lengths located immediately upstream of the translation initiation codon was obtained by direct analyses of a major late mRNA species. A decapping-recapping method was used to specifically substitute a radioactively labeled phosphate for an unlabeled one within the cap structure. RNase H-susceptible sites were made by hybridizing synthetic oligodeoxyribonucleotides to the mRNA encoding a late major structural protein of 11 kilodaltons. Sequences of the type m7G(5')pppAmp (Ap)nUpG. . ., where n varies from a few to more than 40 nucleotides, were deduced by analysis of the length and sequence of RNase H, RNase T1, and RNase U2 digestion products.

Autoradiography↗

Processing, surface expression, and immunogenicity of carboxy-terminally truncated mutants of G protein of human respiratory syncytial virus.

Posttranslational processing and cell surface expression were examined for three C-terminally truncated mutants of the G protein of respiratory syncytial virus expressed from engineered cDNAs. The truncated mutants, encoded by cDNAs designated G71, G180, and G230, contained the N-terminal 71, 180, and 230 amino acids, respectively, of the 298-amino-acid G protein. To facilitate detection of G71, which reacted inefficiently with G-specific antisera, we constructed a parallel set of cDNAs, designated G71/13, G180/13, and G230/13, to encode the same truncated species with the addition of a C-terminal 13-amino-acid reporter peptide which could be detected efficiently with an antipeptide serum. G71, G180, and G230 were expressed as species of Mr 7,500, 48,000, and 51,000, respectively, compared with 84,000 for parental G protein. The proteins encoded by G180 and G230, like parental G protein, contained both N-linked and O-linked carbohydrate. Also, the protein encoded by G71/13 appeared to be O glycosylated, showing that even this highly truncated form contained the structural information required to target the protein for O glycosylation. As for parental G protein, the estimated Mrs of the proteins encoded by G180 and G230 were approximately twice the calculated molecular weight of the polypeptide chain. Experiments with monensin showed that most of this difference between the calculated and observed Mr was due to posttranslational processing in or beyond the trans-Golgi compartment, presumably owing to the addition of carbohydrate or aggregation into dimers or both. Like parental G protein, all three truncated forms accumulated abundantly at the cell surface, and in each case the C terminus was extracellular. Thus, the N-terminal 71 amino acids of the G protein contained all the structural information required for efficient membrane insertion and cell surface expression, whereas the extracellular domain was dispensable for these activities. Cotton rats were immunized with recombinant vaccinia viruses expressing the G71, G180, G230, or parental G protein to compare their abilities to induce serum antibodies and resistance to challenge virus replication. The G71 and G180 recombinants failed to induce significant levels of G-specific antibodies or resistance to challenge, whereas the immunogenicity of G230 equaled or exceeded that of parental G protein. This suggested that the C-terminal 68 amino acids of the 236-amino-acid ectodomain do not contribute to the major epitope(s) of the G protein that is involved in inducing protective immunity.

Amino Acid Sequence↗

Identification of factors specific for transcription of the late class of vaccinia virus genes.

Cytoplasmic extracts made from HeLa cells that have been harvested late after infection with vaccinia virus are capable of specifically transcribing templates containing vaccinia virus late-gene promoters. We applied such an extract to a phosphocellulose column and eluted the proteins with a series of buffers containing successively higher concentrations of NaCl. None of three column fractions alone was capable of specific transcription of a late-gene template. However, specific transcriptase activity could be reconstituted by mixing column fractions, with maximal activity seen when all three fractions were present. The activities present in all fractions were heat labile, resistant to micrococcal nuclease, and present only in extracts from vaccinia virus-infected cells. A quantitative complementation assay was used to further purify one factor, named VLTF-1, over subsequent columns of DEAE-cellulose and hydroxylapatite. VLTF-1 was separated from endogenous RNA polymerase, was a late-promoter-specific transcription factor, and had a sedimentation rate consistent with an apparent Mr of 45,000. The RNA polymerase-containing fraction was not only necessary for transcription with a late-promoter template but alone was capable of specifically transcribing a vaccinia virus early-gene promoter. A further difference between early and late gene transcription in this system was in the ability of the ATP analog beta-8-imidoadenosine-5'-triphosphate (AMP-PNP) to substitute for ATP in supporting specific transcription of only the late-promoter template. The system reconstituted from the various fractions retained the ability to produce the novel poly(A) sequence found on the 5' end of vaccinia virus late messages.

Adenosine Triphosphate↗

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

Base Sequence↗

Vaccinia virus encodes two proteins that are structurally related to members of the plasma serine protease inhibitor superfamily.

Nucleotide sequencing adjacent to the right inverted terminal repetition of the vaccinia virus genome revealed two genes encoding polypeptides that are structurally related to members of the plasma serine protease inhibitor superfamily (SPI). Inclusion in the superfamily is based on extensive amino acid sequence similarities as well as a consensus sequence adjacent to the active-site region near the carboxyl ends of the proteins. The genes designated SPI-1 and SPI-2 are located 10,000 and 17,000 base pairs from the right end of the genome, respectively. The predicted SPI-1 polypeptide is 11 amino acids longer than that of SPI-2, and the deduced masses are 40,471 and 38,125 daltons, respectively. Similarities between SPI-1 and SPI-2 are indicated by the percentage of identical amino acids (44%) and corresponding hydrophobicity plots. The maximum amino acid sequence diversity occurs precisely in the putative active-site region, suggesting that SPI-1 and SPI-2 may inhibit different proteases. SPI-2 is homologous to a previously described cowpox virus gene (D. J. Pickup, B. S. Ink, W. Hu, C. A. Ray, and W. K. Joklik, Proc. Natl. Acad. Sci. USA 83:7698-7702, 1986). Evidence for a cowpox virus homolog of SPI-1 was obtained by DNA hybridization. Thus, the presence of two genes that belong to the plasma serine protease inhibitor superfamily may be characteristic of orthopoxviruses.

Amino Acid Sequence↗

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.

Animals↗

Proliferative T-cell response to HIV envelope glycoprotein in immunized and infected primates and human beings.

Human immunodeficiency virus (HIV)-specific helper T-cell response was studied in human subjects and nonhuman primates either infected with HIV or immunized with different HIV protein preparations. A strong group-specific T-cell response involving T-cell proliferation and lymphokine secretion was observed in immunized chimpanzees and rhesus monkeys as well as HIV-infected chimpanzees and gibbons. HIV-infected people demonstrated a low or no HIV-specific T-cell response. In contrast, five of 14 HIV antibody-negative sexual partners of HIV-infected men recognized one or more T-cell epitopes in the envelope glycoprotein of HIV.

Acquired Immunodeficiency Syndrome↗

Characterization of vaccinia virus DNA topoisomerase I expressed in Escherichia coli.

The putative structural gene encoding the vaccinia virus type I DNA topoisomerase (EC 5.99.1.2) was expressed in Escherichia coli under the control of a bacteriophage T7 promoter. Provision of T7 RNA polymerase resulted in the accumulation to high level of a Mr = 33,000 type I topoisomerase with the properties of the vaccinia enzyme. A simple purification scheme yielded approximately 8 mg of recombinant vaccinia topoisomerase from 400 ml of bacteria. DNA unwinding by the enzyme was stimulated by magnesium, manganese, calcium, cobalt, and spermidine, but inhibited by copper and zinc. Like eukaryotic cellular type I topoisomerases, but unlike the prokaryotic counterpart, the recombinant topoisomerase relaxed positively and negatively supercoiled DNA. The viral topoisomerase I was, however, resistant to the effects of camptothecin, a drug that specifically inhibits cellular type I topoisomerases.

Cloning, Molecular↗

Limited immunological recognition of critical malaria vaccine candidate antigens.

Current vaccine development strategies for malaria depend on widespread immunological responsiveness to candidate antigens such as the zygote surface antigens and the sporozoite coat protein, the circumsporozoite (CS) protein. Since immunological responsiveness is controlled mainly by genes mapping within the major histocompatibility complex (MHC), the humoral immune response to the zygote surface antigens and the cytotoxic T lymphocyte (CTL) response to the CS protein were examined in MHC-disparate congenic mouse strains. Only two of six strains responded to the 230-kilodalton zygote surface antigen and another two strains responded to the 48/45-kilodalton surface antigen. From two mouse strains, expressing between them five different class I MHC molecules, there was recognition of only a single CTL epitope from the CS protein, which was from a polymorphic segment of the molecule. The restricted CTL response to this protein parallels the restricted antibody response to this protein observed in humans and mice. These findings suggest that subunit malaria vaccines now being developed may be ineffective.

Animals↗

Cell-mediated immune response toward viral envelope and core antigens in gibbon apes (Hylobates lar) chronically infected with human immunodeficiency virus-1.

The specific cellular immune response toward envelope and core proteins of human immunodeficiency virus-1 (HIV-1) was investigated in gibbon apes chronically infected with the HTLV-IIIB isolate. After in vitro stimulation of PBMC from infected and control animals with HIV-1 Ag, DNA synthesis, IL-2R expression and IL-2 release were assayed. Cells from infected gibbon apes demonstrated a group-specific response toward whole virus preparations from three divergent HIV-1 isolates (HTLV-IIIB, HTLV-IIIRF, HTLV-IIIMN). Consistent responses were also detected against purified HIV-1 Ag, i.e., native gp120 envelope glycoprotein, recombinant gp160 glycoprotein, a synthetic peptide (peptide 7) representing a highly conserved region of gp120, and purified native core protein p24. In addition, lymphocytes from infected gibbon apes displayed a specific, MHC-restricted, cytotoxic activity against autologous cells expressing HIV-1 envelope or gag proteins. The specific T cell reactivity toward HIV-1 proteins observed in infected gibbons contrasts with findings in HIV-1 infected humans, and may help to explain the apparent discrepancy in the natural history of the infection between the two species.

Acquired Immunodeficiency Syndrome↗

Selective killing of HIV-infected cells by recombinant human CD4-Pseudomonas exotoxin hybrid protein.

It is projected that in the absence of effective therapy, most individuals infected with human immunodeficiency virus (HIV) will develop acquired immune deficiency syndrome (AIDS) and ultimately succumb to a combination of opportunistic microbial infections, malignancies and direct pathogenic effects of the virus. Anti-viral agents, immunomodulators, and inhibitors of specific HIV functions are being tested as potential treatments to alleviate the high morbidity and mortality. An alternative therapeutic concept involves the development of cytotoxic agents that are targeted to kill HIV-infected cells. Here we describe the purification and characterization of a recombinant protein produced in Escherichia coli that contains the HIV-binding portion of the human CD4 molecule linked to active regions of Pseudomonas exotoxin A. This hybrid protein displays selective toxicity toward cells expressing the HIV envelope glycoprotein and thus represents a promising novel therapeutic agent for the treatment of AIDS.

Acquired Immunodeficiency Syndrome↗

Successful vaccination with a polyvalent live vector despite existing immunity to an expressed antigen.

A global vaccination strategy must take into account production and delivery costs as well as efficacy and safety. A heat-stable, polyvalent vaccine that requires only one inoculation and induces a high level of humoral and cellular immunity against several diseases is therefore desirable. A new approach is to use live microorganisms such as mycobacteria, enteric bacteria, adenoviruses, herpesviruses and poxviruses as vaccine vectors. A potential limitation of live polyvalent vaccines, however, is existing immunity within the target population not only to the vector, but to any of the expressed antigens. This could restrict replication of the vector, curtail expression of antigens, and reduce the total immune response to the vaccine. Recently acquired immunity to vaccinia virus can severely limit the efficacy of a live recombinant vaccinia-based vaccine, so a strategy involving closely spaced inoculations with the same vector expressing different antigens may present difficulties. We have constructed a recombinant vaccinia virus that expresses surface proteins from two diverse pathogens, influenza A virus haemagglutinin and herpes simplex virus type 1 (HSV-1) glycoprotein D. Mice that had recently recovered from infection with either HSV-1 or influenza A virus could still be effectively immunized with the double recombinant.

Animals↗

Vaccinia virus encodes a secretory polypeptide structurally related to complement control proteins.

Several polypeptides are secreted into the medium of cells infected with vaccinia virus, a cytoplasmic DNA virus belonging to the poxvirus family. One of these, a polypeptide of relative molecular mass 19,000 is structurally related to epidermal growth factor and binds to epidermal growth factor receptor stimulating proliferation of uninfected cells in vitro and in vivo. Here, we show that a second, and much more abundant secretory polypeptide, is also encoded by vaccinia virus and is structurally related to the superfamily of complement control proteins. Members of this family can block complement-mediated induction of the inflammatory response, and engulfment, killing and lysis of bacteria and viruses.

Amino Acid Sequence↗

DNA-dependent ATPase activity associated with vaccinia virus early transcription factor.

Vaccinia virus early transcription factor (VETF) is required for efficient expression of the early class of viral genes in vitro. The factor copurified with an ATPase activity that was stimulated by DNA. In this report we show that the ATPase remains associated with the factor upon glycerol gradient sedimentation. Under these conditions VETF sedimented at a rate of 7.6 S suggesting that it may be a heterodimer of the Mr 82,000 and 77,000 polypeptides. Of the common nucleoside triphosphates, only ATP and dATP were hydrolyzed by the VETF-associated ATPase. The ATP analog gamma-thio ATP was not a substrate. The VETF-associated ATPase activity was stimulated up to 30-fold by the presence of polynucleotides. DNA was a much more effective cofactor for the ATPase than was RNA, and duplex polydeoxyribonucleotides were preferred. The enzymatic and physical properties of the VETF-associated ATPase distinguished it from all three vaccinia ATPase activities previously described, nucleoside triphosphate phosphohydrolases I and II, and capping enzyme. Except for the preference for double-stranded DNA, the substrate and cofactor requirements of the VETF-associated ATPase most closely resembled those of nucleoside triphosphate phosphohydrolase I. However, VETF-ATPase was not inhibited by polyclonal antibody to the latter enzyme. The association of an ATPase with an early gene transcription factor may explain the previously described requirement for ATP hydrolysis in transcription.

Adenosine Triphosphatases↗

Purification of a factor required for transcription of vaccinia virus early genes.

Partially purified DNA-dependent RNA polymerase from infectious vaccinia virus particles exhibits the following two activities: 1) specific transcription of double-stranded DNA templates containing vaccinia early promoters and 2) nonspecific transcription of single-stranded DNA templates. After further purification of the RNA polymerase, specific transcriptase activity was selectively diminished suggesting the loss of a transcription factor. In agreement with the latter hypothesis, transcriptase activity could be reconstituted by mixing the purified RNA polymerase with certain column fractions. A quantitative complementation assay was developed and used to locate the transcription factor during successive column chromatography steps. The factor eluted as a single peak of activity from single strand DNA-cellulose and phosphocellulose columns. An observation that the transcription factor binds specifically to vaccinia early promoter sequences was exploited in the final affinity chromatography steps. The purified factor was separated from all previously identified vaccinia enzymes and contained two polypeptides of Mr 77,000 and 82,000. A DNA-dependent ATPase activity also copurified with the transcription factor. Although a single template was used for assays during isolation, the purified factor stimulated transcription of three other early genes by 20-30-fold suggesting that it has a general role in conferring promoter specificity for initiation of early transcription.

Chromatography, Affinity↗