Search PubMed⌕ Search

Biomedical subjects

B M Peterlin

Publications and source records attributed to B M Peterlin.

At least 109 records · Page 6Linked to original sources
PubMed1987

Human immunodeficiency virus long terminal repeat responds to T-cell activation signals.

Human immunodeficiency virus (HIV), the causative agent of AIDS, infects and kills lymphoid cells bearing the CD4 antigen. In an infected cell, a number of cellular as well as HIV-encoded gene products determine the levels of viral gene expression and HIV replication. Efficient HIV-replication occurs in activated T cells. Utilizing transient expression assays, we show that gene expression directed by the HIV long terminal repeat (LTR) increases in response to T-cell activation signals. The effects of T-cell activation and of the HIV-encoded trans-activator (TAT) are multiplicative. Analysis of mutations and deletions in the HIV LTR reveals that the region responding to T-cell activation signals is located at positions -105 to -80. These sequences are composed of two direct repeats, which are homologous to the core transcriptional enhancer elements in the simian virus 40 genome. Our studies reveal that these elements function as the HIV enhancer. By acting directly on the HIV LTR, T-cell activation may play an important role in HIV gene expression and in the activation of latent HIV.

Base Sequence↗
PubMed1987

Chromatin structure of the HLA-DR alpha gene in different functional states of major histocompatibility complex class II gene expression.

We utilized DNase I hypersensitivity mapping to study chromatin structure within the HLA-DR alpha gene. We found a single DNase I-hypersensitive site coinciding with the HLA-DR alpha gene promoter in all cells studied. Moreover, in cells that constitutively express HLA-DR, two additional DNase I-hypersensitive sites were observed. These lie within the first intron of the HLA-DR alpha gene and encompass DNA sequences that share homologies with regulatory loci of the immunoglobulin and immune response genes, as well as with core enhancer consensus sequences.

Base Sequence↗
PubMed1987

Transcriptional enhancers in the HLA-DQ subregion.

Using transient expression assays, the HLA-DQ alpha and HLA-DQ beta genes of the human major histocompatibility complex were screened for cis-acting regulatory elements. Two regions in the HLA-DQ alpha gene and one in the HLA-DQ beta gene were identified which fulfilled the criteria for transcriptional enhancers.

Chromosome Mapping↗
PubMed1986

Expression of T cell receptor genes in human B cells.

We analyzed the transcription and rearrangement of the T cell antigen receptor (Ti) genes Ti alpha and Ti beta in human B cell, T cell, and myeloid cell lines, as well as in purified tonsillar B and T cells. All four B cell lines examined, as well as one of two myeloid cell lines, expressed low levels of truncated Ti beta transcripts, as did freshly purified tonsillar B cells. Two of the B cell lines and one of the myeloid lines also expressed truncated Ti alpha transcripts, while tonsillar B cells did not. Sequence analysis of cDNA clones from a B cell line demonstrated that these truncated Ti alpha and Ti beta transcripts were composed of unrearranged J and C gene segments. Comparison of cDNA clones from T and B cells suggests that D alpha genes or N regions contribute to the formation of Ti alpha transcripts in T cells but not in B cells. None of the B cell or myeloid cell lines in this study showed evidence of Ti beta gene rearrangements by Southern blotting. Our data, and other studies of gene rearrangements in human tumors, demonstrate that the level of Ti beta transcriptional activity and the frequency of Ti beta gene rearrangements are correlated in all cell types examined. Thus, our data support the accessibility model of antigen receptor gene rearrangement, whereby the susceptibility of gene segments to recombination enzymes is correlated with their transcriptional activity.

Amino Acid Sequence↗
PubMed1986

Secondary structure of poliovirus RNA: correlation of computer-predicted with electron microscopically observed structure.

A secondary structure map of poliovirus 1, strain Mahoney, RNA was determined by psoralen crosslinking the (+) strand and visualizing the structures in the electron microscope. Hairpins and looped hairpins were observed, and the size and distribution were measured. To orient map features the 3' end of the RNA was linked to polybromodeoxyuridine [poly(BUdR)]SV40 and histograms were constructed from these measurements. Secondary structure maps of the RNA were likewise constructed from the results of computer prediction programs for secondary structure. The programs used were those of M. Zuker (RNA2 and FOLD) which calculate a minimal global energy for a given sequence. Many single hairpins predicted by both RNA2 and FOLD showed a correlation with the histograms of hairpin structures of RNA crosslinked with psoralen. A secondary structure map was also constructed for the entire 7433 bases using the option in FOLD which allows multi-branch loops by folding uniformly stepped overlapping segments. Any structure that occurred at or greater than a given frequency was selected and mapped with respect to genome position. A correlation in structured regions was seen between psoralen-derived and computer-predicted maps of secondary structure. Furthermore, a region of large loops from base position 681 to 3899 was noted that corresponded to frequently observed large loop(s) in electron micrographs of psoralen preparations of RNA. Agreement between the two methods of determining secondary structure strengthens the credibility of the computer-aided methods used for predicting secondary structure and allows us to suggest an overall secondary structure map for poliovirus RNA.

Computers↗
PubMed1986

Methylation patterns of HLA-DR alpha genes in six mononuclear cell lines.

The relationship between DNA methylation and HLA-DR alpha gene expression was investigated in six mononuclear cell lines. RPMI-4265 (B cell) and HUT-78 (T cell) constitutively express HLA-DR. HL-60 (myelomonocyte) and U-937 (monocyte) can be induced to express HLA-DR. Jurkat and Molt-4 (T cells) do not and cannot be induced to express HLA-DR. Based on the known nucleotide sequence of the HLA-DR alpha gene, methylation-sensitive restriction endonucleases Msp I, Hpa II, Hha I, Ava I, Hae II, and Sma I were used to detect the CpG methylation in three regions of the HLA-DR alpha gene: the 5'flanking region, the exon 1 region, and the coding region containing exons 2, 3, 4, and 5. This precise mapping of CpG methylation yielded no correlation between DNA hypomethylation and HLA-DR alpha gene expression. In all cell lines, exon 1 region is hypomethylated, whereas 5' and coding regions are hypermethylated. Whereas hypermethylation of the coding region does not block transcription, hypomethylation of the exon 1 region may be essential but is clearly not sufficient for HLA-DR alpha gene transcription. This exon 1 region demethylation may result in an open (deoxyribonuclease I hypersensitive) chromatin conformation around the promoter where trans-acting regulatory factors presumably bind and initiate HLA-DR alpha transcription. In the course of this study, a novel Msp I polymorphism in the intron 1 of the HLA-DR alpha gene was found.

Cell Line↗
PubMed1986

Elevated levels of mRNA can account for the trans-activation of human immunodeficiency virus.

The genome of human immunodeficiency virus encodes a protein that dramatically elevates amounts of viral proteins. The precise mechanism of this trans-activation remains to be established. It has been reported that trans-activation can occur without major changes in the levels of mRNA. We constructed recombinant plasmids containing those viral sequences required in cis for trans-activation linked to the chloramphenicol acetyltransferase gene. These plasmids were introduced into cultured cells in either the presence or absence of a second plasmid that directed expression of the viral trans-activator protein. Expression of the chloramphenicol acetyltransferase gene was measured at the level of protein (by enzymatic assay) and RNA (by ribonuclease protection and primer extension). Our results demonstrate that trans-activation is accompanied by large increases in mRNA levels; these increases may be sufficient to explain the elevated levels of trans-activated protein.

Deltaretrovirus↗
PubMed1985

Regulation of expression of the human interferon gamma gene.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.

Base Sequence↗
PubMed1985

Molecular analysis of the bare lymphocyte syndrome.

The bare lymphocyte syndrome is a disorder in which class I histocompatibility antigens fail to be expressed normally on the surface of lymphocytes. Utilizing complementary DNA probes for both beta 2-microglobulin and class I genes, the molecular basis for this syndrome was investigated in a family with two siblings exhibiting the bare lymphocyte syndrome. Southern blot analysis demonstrated no gross internal defect in either class I or beta 2-microglobulin genes. Northern blot analysis of class I and beta 2-microglobulin messenger RNAs also revealed no qualitative difference between affected and unaffected family members. In contrast, quantitation of both class I and beta 2-microglobulin transcripts demonstrated each to be decreased in patients when compared to controls. Moreover, the decrease in both transcripts was coordinate. These results suggest that the bare lymphocyte syndrome may represent a pretranslational regulatory defect of both class I and beta 2-microglobulin gene expression.

Antigens, Surface↗
PubMed1984

Expression of HLA-DR by a human monocyte cell line is under transcriptional control.

Several studies have demonstrated that the expression of Ia molecules by macrophages is not constitutive but can be enhanced by soluble factors from activated T cells. This induced expression of Ia appears to be causally important in certain accessory functions such as antigen presentation. While the phenomenon of Ia induction is clear, the mechanism by which this occurs has not been determined. Therefore, experiments were designed to investigate the molecular events leading to expression of the human Ia molecule, HLA-DR. To accomplish this, the human monocytoid cell line U 937, which does not express any detectable HLA-DR molecules were used. Utilizing a cDNA probe for the alpha chain of HLA-DR and total cellular RNA, it could be demonstrated that resting U 937 lacked detectable HLA-DR transcripts. Digestion of genomic DNA from U 937 with the isoschizomers Msp I and Hpa II followed by analysis of the restriction fragments on Southern blots demonstrated the HLA-DR alpha chain genes to be methylated. Addition of 5-azacytidine, an analogue of cytidine which causes hypomethylation of DNA to U 937 caused hypomethylation of HLA-DR alpha chain genes but did not, by itself, lend to the appearance of HLA-DR molecules or transcripts. However, treatment of U 937 with 5-azacytidine followed by addition of either culture fluids from activated T cells or human recombinant gamma interferon did lead to the rapid appearance of abundant, mature HLA-DR transcripts and surface HLA-DR molecules. The results of these studies provide the first demonstration that methylation plays a role in the expression of human Ir genes and that induced expression of Ia molecules by soluble factors from T cells, including gamma interferon, is accompanied by the rapid appearance of Ir gene transcripts.

Cell Line↗
PubMed1983

"Bare lymphocytes" without immunodeficiency.

"Bare lymphocytes," which cannot be typed for the HLA-A,B, and C antigens were observed in two siblings, nine and six years of age. The elder child presented with aplastic anemia and was being considered for bone marrow transplantation. The younger child was healthy. The inability to phenotype both children for these three gene products persisted throughout the 21-month period of observation. The DR antigens were demonstrable which rendered it possible to deduce their A, B, and C genotype from the typing of the other four family members. Although alloantisera failed to detect the antigens on peripheral blood lymphocytes, monoclonal antibodies demonstrated reduced amounts of the HLA-A,B, and C antigens on the cells. The reduced level was confirmed following EBV transformation of the cells. After prolonged culture, HLA antigens immunoprecipitated from the cell extracts were normal in amount, molecular weight, and polypeptide composition. Southern blot analysis did not reveal gross genomic rearrangements. A regulatory defect leading to the expression of these Class I antigens is postulated.

Anemia, Aplastic↗
PubMed1983

Use of synthetic oligonucleotide probes complementary to genes for human HLA-DR alpha and beta as extension primers for the isolation of 5'-specific genomic clones.

We have synthesized 175-nucleotide-long probes for the DNA of human histocompatibility antigens HLA-DR alpha and beta by extending on poly(A)+ mRNA from B-cell lines with short synthetic deoxyribonucleotide primers complementary to the predicted nucleotide sequence of the NH2 terminus of both polypeptides. The synthesis of the probe for the alpha-chain DNA was a two-step process starting with 11-mers which were extended by dideoxynucleotide chain termination experiments to a 20-mer of predicted sequence. The synthesized 20-mer was then used to generate a 175-nucleotide cDNA probe which was shown to encode the appropriate amino acids for the alpha chain and was used to select a human genomic DNA clone containing the coding sequences for HLA-DR alpha. For the beta polypeptide an 18-mer homologous to the NH2-terminal sequence of a cDNA clone from another B-cell line was used to extend on poly(A)+ mRNA isolated from a B-cell line. Preliminary sequence analysis of a 175-base-long extension product indicates a match of the cDNA sequence to the published sequence of a clone for HLA-DR beta. Information from these extension experiments helps to establish the sensitivity and specificity of the primer extension method.

Amino Acid Sequence↗
PubMed1980

Immunoglobulin gamma 1 heavy chain gene: structural gene sequences cloned in a bacterial plasmid.

Immunoglobulin gamma 1 heavy chain cDNA was cloned into an Escherichia coli plasmid pCR1 and its nucleotide sequence was determined. The hybrid plasmid contained approx. 900-bases-long gamma 1 chain cDNA sequence, including the complete sequence of the CH2 and CH3 domains and the 3' untranslated region, and partial sequence of the CH1 domain. The nucleotide sequence predicts an extra lysine at the carboxyl-terminus of the gamma 1 chain. Comparison of the nucleotide sequence of 3' untranslated regions of the immunoglobulin gamma 1 chain and kappa light chain showed a significant homology although lengths are quite divergent.

Animals↗
PubMed1979

DNA replication by bacteriophage T4 proteins. The T4 43, 32, 44--62, And 45 proteins are required for strand displacement synthesis at nicks in duplex DNA.

The T4 bacteriophage gene 43 (T4 DNA polymerase), 32 (DNA helix-destabilizing protein), and 45 proteins and the complex of the gene 44 and 62 proteins are all required for DNA synthesis beginning at single-stranded breaks in duplex DNA. This synthesis occurs by strand displacement and is not dependent on ribonucleotides, the T4 gene 41 protein, or the T4 initiating protein, each of which is required to begin new chains on single-stranded templates. Electron microscopic analysis shows that duplex molecules with long single-stranded branches are the predominant products of this strand displacement synthesis.

Coliphages↗
PubMed1978

Intervening sequence of DNA identified in the structural portion of a mouse beta-globin gene.

The unusual electron microscopic appearance of a hybrid formed between 9S mouse beta-globin mRNA and its corresponding cloned gene segment is caused by at least one, and possibly two, intervening sequences of DNA that interrupt the mouse beta-globin gene. Such an interpretation is consistent with a paradoxical restriction site pattern previously noted in this gene and with the nucleotide sequence of that portion of the gene that spans both structural and intervening sequences. The large intervening sequence, approximately 550 base pairs in length, occurs in the structural globin sequence and immediately follows the beta-globin codon corresponding to amino acid 104. A smaller, putative intervening sequence is located close to the 5' end of the beta-globin-coding sequence but may reside beyond its initiation codon. The beta-globin gene thus appears to be encoded in two, and possibly three, discontinuous segments.

Animals↗
PubMedDate not supplied

Transcriptional regulation of HLA-DRA gene.

Transcriptional regulation of class II genes is complex. DRA, for example, is expressed in both tissue-specific and lymphokine-inducible fashion. High levels of expression in B and activated T cells depend upon a lymphoid-specific transcriptional enhancer located in the first intron and on the upstream and downstream promoter elements. Conserved upstream promoter Z and X sequences (CUS) are the main determinants of this complex regulation. At least four distinct trans-acting factors that might be differentially expressed in various cell types bind to these Z and X boxes. These are members of JUN, helix-loop-helix (HLH), C/EBP and ETS families of proteins.

B-Lymphocytes↗