Experimental data are reported on DNA-cleaving activity of the synthetic netropsin analogs consisting of the two N-propylpyrrole carboxamide units linked covalently through two or three glycine residues to a copper-chelating tripeptide glycyl-glycyl-L-histidine. Incubation of DNA restriction fragment and netropsin analog in the presence of ascorbate, hydrogen peroxide and Cu2+ ions resulted in selective cleavage of the DNA at or near the preferred sites for binding of netropsin analog. A similar cleavage pattern is observed after X-ray irradiation of DNA complexes with netropsin analogs tethered with Cu2+ ions. The cleavage patterns are found to be dependent on the length of the connecting chain between the histidine-containing tripeptide and netropsin analog. The netropsin analog containing three glycine residues in the connecting chain, but not the analog with a shorter linker chain, can generate an intense cleavage of one of the two polynucleotide chains at a position corresponding to the presumed binding site for the dimeric ligand species. More than 50% of the total DNA can be cleaved at this position after X-ray irradiation. From analysis of the nucleotide sequences surrounding the preferred cleavage site on several DNA fragments we found that the consensus is 5'-TTTTNCA*AAA-3', where N is an arbitrary nucleotide. The Cu(2+)-mediated cleavage of DNA occurs at the second adenine (indicated by an asterisk) from the 5'-end of the sequence. The greatest cleavage activity is observed when the molar ratio of Cu2+ to the netropsin analog is equal to 0.5. Evidently, the Cu(2+)-ligated and unligated oligopeptide species interacts with each other to form a heterodimer bound to DNA at the cleavage site. To test the validity of this model we have studied the binding of unligated netropsin analog and netropsin analog complexed with Cu2+ ion to a self-complementary oligonucleotide 5'-GCGTTTTGCAAAACGC-3'. It is found that binding of Cu(2+)-ligated netropsin analog to the DNA oligomer preincubated with unligated form of the oligopeptide is a cooperative process for which interactions between the two bound ligands are responsible. The cooperativity parameter is estimated to be on the order of factor 6. Finally, a model is proposed in which a heterodimer stabilized by interligand beta-sheet binds in the minor DNA groove.

Amino Acid Sequence↗

PubMedDate not supplied

[New packing of B-DNA in crystals].

Two crystal forms of the self-complementary tetramer GpGpCpC have been obtained by phase diagram technique: P6(2)22/P6(4)22. a = b = 67.7 A, c = 105.6 A and P3(2)12/P3(1)12, a = b = 116.9 A. c = 116.4 A. Both crystals form diffract at least up to 3.2 A. Diffraction patterns of both crystal forms have strongest base-stacking reflections corresponding to the Bragg spacing 3.38 A which is typical for B-DNA. Moreover the self-rotation function of the first crystal form shows regular located two-fold pseudo-axes periodicity of which also indicates that this is B-conformation. The same conclusion can be reached on the basis of the crystal packing of the duplexes in the unit cell. It should be emphasized that this is a new example of B-DNA crystal packing.

Crystallization↗

PubMedDate not supplied

[Site-specific mutagenesis of residue Lys-172 of phage T7 RNA polymerase: characterization of transcription properties of mutant proteins].

Lys-172 residue of bacteriophage T7 RNA polymerase (T7RP) was substituted for Leu and Gly and Lys-172, Arg-173 were deleted by the site-directed mutagenesis using synthetic oligonucleotides. The specific activity of all mutant enzymes did not differ significantly from that of the wild-type (w.t.) T7RP while for Gly-172 mutant (G172) it was somewhat lower. Leu-172 (L172) and deletion (DEL172-3) mutants were able to direct RNA synthesis on the templates lacking the T7 promoter. DEL172-3 was not able to synthesize extraneous RNA sequences in addition to the expected run-off transcripts. L172 and DEL172-3 mutants revealed altered template specificity toward various DNA templates and showed the lower stability of enzyme-promoter complexes. The possible role of Lys-172 likely belonging to an interdomain "stretch" is discussed.

Amino Acid Sequence↗

PubMedDate not supplied

[Conformational transition of parallel DNA in solutions with decreased water activity].

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.

Base Sequence↗

PubMedDate not supplied

[The existence of the ribonucleoprotein branching enzyme in rabbit skeletal muscle and ribozyme corresponding to it].

Amylose isomerase (AI) preparations were isolated from rabbit muscles after Petrova et al., as well as by the additional fractionation steps. Their homogeneity, enzymatic activity and RNA, isolated from those preparations, were characterized. AI preparations, as described by Petrova et al., proved to be heterogeneous in respect to the protein and RNA; by using additional fractionation methods RNA and protein have been separated from each other, which proves that a homogeneous stable ribonucleoprotein complex, exerting AI activity, does not exist. It was shown by three independent methods that AI preparations isolated after Petrova do not display branching, but have amylolytic activity. RNA, isolated along with the AI preparations, proved to be mainly total tRNA degraded to different degrees. No RNA corresponding to the previously sequenced 2.5S RNA could be detected in these preparations. RNA preparations do not manifest neither branching, nor amylolytic activity. Our data prove that there is no ribozyme, whose existence has been suggested previously.

1,4-alpha-Glucan Branching Enzyme↗

PubMedDate not supplied

[Amplification using one-sided polymerase chain reaction, cloning and determination of primary structure of 5'-untranslated cDNA segments coding the somatogenic growth hormone receptor from rat liver].

The method of ligation-mediated, single-sided polymerase chain reaction was applied for the amplification of 5'-untranslated regions of cDNA coding for somatogenic growth hormone receptor from rat liver. The products of polymerase chain reaction were cloned and sequenced. Two variants of 5'-untranslated sequences of growth hormone receptor cDNA corresponding to products of alternative splicing of pre-mRNA were found.

Animals↗

PubMedDate not supplied

[Hybridization of DNA with oligonucleotides immobilized in a gel: a convenient method for recording single base replacements].

In an attempt to develop a reliable system for DNA sequence analysis with multiple hybridization probes, oligonucleotides down to 8 bases long were covalently immobilized in a thin layer of polyacrylamide gel fixed on a glass plate. It was shown possible to detect single base changes in DNA by hybridization of the immobilized oligonucleotides with radioactively and fluorescently labeled DNA fragments. Moreover, it was found that dissociation temperatures of differently GC-rich duplexes could be equalized by appropriate choice of immobilized oligonucleotides concentrations. A model accounting for this phenomenon is presented. In order to make the system more compact, a rectangular matrix of 200 mm dots of immobilized oligonucleotides ("hybridization chip") was designed which offered the sensitivity of 20 attomoles per dot for fluorescent DNA fragment. The applications and perspectives of the approach are discussed.

Base Composition↗

PubMedDate not supplied

[The effect of temperature and ionic strength on the electrophoretic motility of synthetic DNA fragments].

The following DNA fragments were studied: T5A5, U5G5, C5G5, RI (CCGAATTCGG), and RV (CCGATATCGG). The ligated decamers were run on 8% polyacrylamide gel. The PAGE anomaly was measured by the R-factor. Under standard conditions R is maximum for A5G5 and U5A5 (R = 1.9-2.0); R has intermediate values for RI and T5A5 (R200 = 1.05-1.10). T5A5 exhibits unusual non-monotonous temperature dependence of the R-factor, which reaches its maximum at 35 degrees C. Based on this fact we make two conclusions: (i) PAGE anomaly is highly sensitive to the DNA winding angle tau, (ii) tau = 36 degrees for T5A5 under these conditions. For A5G5, RI and RV the temperature dependence of the R-factor is conventional: R monotonously decreases. Conceivably tau less than 36 degrees for these sequences. In the presence of 10 mM of MgCl2 the anomaly increase for all fragments, except for T5A5; e.g. for C5G5R150 R200 = 1.2. This testifies to the moderate curvature of C5G5. The results of the measurements were interpreted on the basis of the wedge AA and junction An/B models. To get a better agreement with the experiment these models should be supplemented with the bends in the YR dimers (TA, CG, CA) directed into the major groove and with the bends in AT directed into the minor groove.

Base Sequence↗

PubMedDate not supplied

[Insertion of (dA-dT)n sequences into the regulatory region of the pho5 gene inhibits its expression].

We have studied the effect of some regular sequences namely (dA-dT)n, (dA)n and (dG-dC)n on the Saccharomyces cerevisiae PHO5 gene expression. These sequences were inserted into the ClaI site, located between two phosphate-responsible upstream activating sequences (UAS's). A modified PHO5 gene cloned in vector plasmids was used to transform the pho3, pho5 yeast strain and the level of acid phosphatase expression in various conditions was measured. We show that the insertion of (dA-dT)n blocks, but not (dA)n or (dG-dC)n, leads to the dramatic decrease of PHO5 gene expression in a derepressed state. (dA-dT)n inserts also inhibit the expression of PHO5 gene which was put under the control of heterologous UASgal.

Alkaline Phosphatase↗

PubMedDate not supplied

[Complete assignment of signals in 1D and 2D H-NMR spectra of a 17-member oligonucleotide, a model symmetrical analog of lambda operators].

A synthetic analog of lambda phage operators, a symmetric duplex of oligonucleotides, was studied by 1H NMR at 400 MHz. Signals in the spectrum of imino protons of the duplex in H2O were assigned based on the results of NOE experiments and temperature dependences. Resonance assignment of the non-exchangeable protons of bases and deoxyribose was performed by analysing the NOESY spectrum obtained in the single experiment. The results indicate that the major part of the duplex has a conformation similar to the B-form of DNA, and the region of the central non-complementary base pair exhibits deviations from the regular structure.

Adenosine↗

PubMedDate not supplied

[Parallel double helix and tertiary structure of nucleic acids].

The thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3' (parAT), 3'-d(AT)5pO(CH2)5Opd(AT)5-5' (antiAT), 3'-d(A)10pO(CH2)6Op(T)10-3' (parA-T) and 3'd(A)10pOX X (CH2)6Opd(T)10-5' (antiA-T) in 0.01 M phosphate buffer at pH 7 in presence 0.1, 0.25, 0.5 and 1.0 M NaCl have been studied. It was shown that at lower temperature (0-20 degrees C) all oligomeres exist as complexes of two (canonic duplex) or four (eight) molecules of oligonucleotides, but at higher temperature (30-70 degrees C)- as hairpins with parallel (parAT and parA-T) of antiparallel (antiAT and antiA-T) orientation of chains. Thermodinamic parameters of separated strands-hairpins and hairpins--"low temperature complexes" transition were computated from the melting curves [A260 (T)] by nonlinear regression. AntiA-T was shown by ethidium bromide binding to exist at low strength (0.01 M phosphate buffer without NaCl) as four-stranded complex from two antiparallel double stranded helices parallely oriented and bonded by satisfy hydrogen-bond of groups not involved in WC-pairing. At higher ionic strength the two of such tetramers was conjugated by hydrophobic interaction into octamers. We speculate that four-stranded complexes serves to bring together, and zipper up two antiparallel double stranded helices at replication of DNA, cross-over of gomologues chromosomes and other biochemically important processes.

Anticodon↗

PubMedDate not supplied

[Study of the structure of phage lambda operator OR1 using two-dimensional 1H-NMR-spectroscopy].

NOESY spectroscopy at 500 HMz was employed to assign resonances of nonexchangeable protons in the 1H NMR spectrum of the synthesized 17 base pair duplex of deoxyribonucleotides comprising the OR1 operator, one of the specific binding sites for the bacteriophage lambda cro repressor. A pure absorption spectrum that was obtained by the phase sensitive detection technique allowed to perform a resonance assignment of base and deoxyribose protons, excepting H-5'- and H-5"-protons, on the basis of a single NOESY experiment, mixing time 200 ms. The sequential assignment strategy for 2D NMR spectra of oligonucleotides was used for this purpose. The data obtained and the previous results on OR3 are discussed in the view of the conformation of operators in solution. It is shown that both duplexes exist in the DNA B-form with its intrinsic anti conformation of the nucleotides. Conformation of DNA segments with identical primary structures are similar, and local deviations from the classical B-form are determined by a nucleotide sequence.

Bacteriophage lambda↗

PubMedDate not supplied

[1H-NMR study of the OR1 operon in bacteriophage lambda. I. Assignment of signals from imino protons and adenine C2 protons].

An oligodeoxyribonucleotide composed of 17 residues, d(TATCACCGCCAGAGGTA), and a complementary chain were synthesized. Their duplex was identical with the operator OR1, the binding site for bacteriophage lambda cro and c1 repressors. The 1H NMR spectra (500 MHz) of the duplex imino and aromatic protons were studied at 10, 20 and 25 degrees C. Signals from the imino protons of complementary base pairs and from the C2 protons of adenine (with the exception of the duplex terminal nucleotides) were assigned using the NOE technique and the known characteristics of short DNA fragment melting. No signals from the imino protons of the terminal base pairs were detected even at 10 degrees C due to fraying which increased as the temperature was raised. The assignment of signals can be used to identify centers of interaction between the operator OR1 and repressors, as well as to study possible local changes in DNA geometry.

Adenine↗

PubMedDate not supplied

[A system of EcoRV restriction-modification: genes, enzymes and synthetic substrates].

The genes, encoding the restriction endonuclease and modification methylase EcoRV have been cloned from the natural plasmid pLG13 into pBR32 derivative vector pIL233. A resultant clone, expressing both enzyme activities, was used as a source of DNA for sequencing these genes by a procedure, that employed construction of deletion derivatives used to locate borders (by means of a functional test) and to sequence ca. 300 bp near the deletion breakpoint. From the sequence data, we infer that the endonuclease, a 29 KDa protein, and the methylase, a 36 KDa protein, are transcribed from a 310 bp intergenic region in opposite directions. There is no apparent homology between the enzymes and genes of the EcoRI and the EcoRV systems. A synthetic decamer, containing the EcoRV endonuclease recognition sequence and a phosphoamide bond at the cleavage point, is not cleaved by the highly purified endonuclease; the unmodified synthetic decamer is cleaved at the same conditions, only that the cleavage occurs to produce a blunt end--GAT/ATC, and not in a place previously reported (GATAT/C).

Base Sequence↗