Search PubMed⌕ Search

Biomedical subjects

B Johansson

Publications and source records attributed to B Johansson.

At least 433 records · Page 24Linked to original sources
PubMed1993

Pre-compiling medical logic modules into C++ in building medical decision support systems.

Development of medical knowledge bases is a time-consuming process, and no single medical institution can develop medical knowledge bases covering all areas of medicine. The use of medical knowledge representation standards such as the Arden Syntax is an attempt to enhance the writability and readability of computer-stored knowledge and facilitate transfer and sharing among institutions. A method for the realisation of decision support systems based on knowledge formulated according to the Arden Syntax is presented. An essential tool in this process is a medical logic module (MLM) pre-compiler, translating MLMs into an object-oriented programming language, C++. Advantages of the C++ approach compared with other alternatives are discussed.

Artificial Intelligence↗
PubMed1993

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Base Sequence↗
PubMed1993

A cross-national self-report measure of depressive symptomatology.

The Center for Epidemiological Studies Depression scale (CES-D) was administered in Swedish to two representative samples, one aged 84 to 90 (mean = 87), the second aged 29 to 95 (mean = 61). There were both linear and quadratic differences with age: the oldest individuals were highest on depressive symptoms, but younger adults were higher than middle-aged. Dimensions or subscales identified by previous studies were generally replicated, including a sadness and depressed mood factor, a psychomotor retardation and loss of energy factor, and a well-being factor (on which items are reverse-scored to indicate depression). The findings support cross-national use of the CES-D to assess self-reported symptoms of depression in adults and older adults.

Adult↗
PubMed1993

Karyotypic abnormalities in tumours of the pancreas.

Short-term cultures from 20 pancreatic tumours, three endocrine and 17 exocrine, were cytogenetically analysed. All three endocrine tumours had a normal chromosome complement. Clonal chromosome aberrations were detected in 13 of the 17 exocrine tumours: simple karyotypic changes were found in five carcinomas and numerous numerical and/or structural changes in eight. When the present findings and those previously reported by our group were viewed in conjunction, the most common numerical imbalances among the 22 karyotypically abnormal pancreatic carcinomas thus available for evaluation turned out to be, in order of falling frequency, -18, -Y, +20, +7, +11 and -12. Imbalances brought about by structural changes most frequently affected chromosomes 1 (losses in 1p but especially gains of 1q), 8 (in particular 8q gains but also 8p losses), and 17 (mostly 17q gain but also loss of 17p). Chromosomal bands 1p32, 1q10, 6q21, 7p22, 8p21, 8q11, 14p11, 15q10-11, and 17q11 were the most common breakpoint sites affected by the structural rearrangements. Abnormal karyotypes were detected more frequently in poorly differentiated and anaplastic carcinomas than in moderately and well differentiated tumours.

Aged↗
PubMed1993

N-formyl peptide receptors in human neutrophils display distinct membrane distribution and lateral mobility when labeled with agonist and antagonist.

Receptors for bacterial N-formyl peptides are instrumental for neutrophil chemotactic locomotion and activation at sites of infection. As regulatory mechanisms for signal transduction, both rapid coupling of the occupied receptor to cytoskeletal components, and receptor lateral redistribution, have been suggested (Jesaitis et al., 1986, 1989). To compare the distribution and lateral diffusion of the nonactivated and activated neutrophil N-formyl-peptide receptor, before internalization, we used a new fluorescent N-formyl-peptide receptor antagonist, tertbutyloxycarbonyl-Phe(D)-Leu-Phe(D)-Leu-Phe-OH (Boc-FLFLF, 0.1-1 microM), and the fluorescent receptor agonist formyl-Nle-Leu-Phe-Nle-Tyr-Lys (fnLLFnLYK, 0.1-1 microM). Fluorescent Boc-FLFLF did not elicit an oxidative burst in the neutrophil at 37 degrees C, as assessed by chemiluminescence and reduction of p-nitroblue tetrazolium chloride, but competed efficiently both with formyl-methionyl-leucyl-phenylalanine (fMLF) and fnLLFnLYK. It was not internalized, as evidenced by confocal microscopy and acid elution of surface bound ligand. The lateral mobility characteristics of the neutrophil fMLF receptor were investigated with the technique of FRAP. The diffusion coefficient (D) was similar for antagonist- and agonist-labeled receptors (D approximately 5 x 10(-10) cm2/s), but the fraction of mobile receptors was significantly lower in agonist- compared to antagonist-labeled cells, approximately 40% in contrast to approximately 60%. This reduction in receptor mobile fraction was slightly counteracted, albeit not significantly, by dihydrocytochalasin B (dhcB, 5 microM). To block internalization of agonist-labeled receptors, receptor mobility measurements were done at 14 degrees C. At this temperature, confocal microscopy revealed clustering of receptors in response to agonist binding, compared to a more uniform receptor distribution in antagonist-labeled cells. The pattern of agonist-induced receptor clustering was less apparent after dhcB treatment. To summarize, this work shows that activated N-formyl peptide receptors aggregate and immobilize in the plane of the neutrophil plasma membrane before internalization, a process that is affected, but not significantly reversed, by cytochalasin. The results are consistent with a model where arrested receptors are associated mainly with a cytochalasin-insensitive pool of cytoskeletal elements.

Amino Acid Sequence↗
PubMed1993

Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

Adolescent↗
PubMed1993

Effects of adenosine A1 and A2 receptor activation on electrically evoked dopamine and acetylcholine release from rat striatal slices.

The authors investigated how electrically evoked [3H]dopamine (DA) and [14C]acetylcholine (ACh) release in the rat striatum is affected, directly or indirectly, by adenosine A1 and A2A receptor activation. Striatal slices, preincubated with [3H]DA and [14C] choline, were superfused continuously and subjected to electrical field stimulation. The electrically evoked release of both [3H] and [14C] was tetrodotoxin sensitive and calcium dependent. The release of both labels was augmented by haloperidol and sulpiride but only the [14C]ACh release was increased by 7-chloro-2,3,4,5-tetrahydro-3-methyl-5-phenyl-1H-3-benzazepine-7-ol (each at 1 microM). The A1 receptor-selective agonist cyclohexyladenosine and the A2A receptor-selective agonist 2-[4-(2-carboxymethyl)-phenethylamino]-5'-N-ethylcarboxamido adenosine (CGS 21680) both caused a concentration-dependent (range, 0.01-1 microM) inhibition of electrically evoked DA and ACh release and with a surprisingly similar potency. The potency of both compounds, and particularly of cyclohexyladenosine, increased when they were allowed to equilibrate for a longer period with the slices. The effect of both compounds was blocked by the A1-selective antagonist 1,3-dipropyl-8-cyclopentyl xanthine (0.1 microM). CGS 21680 never caused any stimulation of DA or ACh release. The ability of the D2 agonist quinpirole to inhibit ACh release was reduced by CGS 21680 in the presence or absence of 0.1 microM 1,3-dipropyl-8-cyclopentyl xanthine. CGS 21680 did not alter the D2 receptor inhibition of DA release. In summary, adenosine analogs inhibit DA and ACh release from rat striatum by a receptor that may be different from those hitherto characterized.(ABSTRACT TRUNCATED AT 250 WORDS)

Acetylcholine↗
PubMed1993

Integrating decision support, based on the Arden Syntax, in a clinical laboratory environment.

A clinical decision support system prototype have been developed in the clinical laboratory environment. The knowledge base consists of Medical Logic Modules, written in the Arden Syntax, and the work describes how these modules can be written, evoked and executed in a system, that is integrated with a laboratory information system, and facilitate real time validation of laboratory data. Tools and methods for building a decision support system are described and design aspects, such as database access, system validation and platform independence, are discussed.

Artificial Intelligence↗
PubMed1992

Effects of mono- and divalent ions on the binding of the adenosine analogue CGS 21680 to adenosine A2 receptors in rat striatum.

The effect of monovalent and divalent cations on equilibrium binding of the adenosine A2-selective agonist ligand CGS 21680 (2-[p-(2-carbonylethyl)phenylethylamino]-5'-N-ethylcarboxami doadenosine) to membranes prepared from rat striatum was examined. Competition experiments with cyclohexyladenosine, 2-chloroadenosine, N-ethylcarboxamidoadenosine and CGS 21680 suggest that at 2 nM [3H]CGS 21680 binds to a single site with the pharmacology of an A2a receptor. Magnesium and calcium ions caused a concentration-dependent increase in binding that reached about 10-fold at 100 mM. Manganese ions had a biphasic effect on binding with a maximal increase at 5 mM. Lithium, sodium and potassium ions all caused a concentration-dependent decrease of binding. Sodium was most potent, potassium least. At 200 mM ion concentration, the inhibition of binding was 88% by sodium, 47% by lithium and 29% by potassium ions. The effect of sodium chloride was the same as that of sodium acetate. The effect of sodium ions was essentially similar to that of Gpp(NH)p. However, sodium ions produced a larger effect than even maximally effective concentrations of Gpp(NH)p. The maximal inhibition by Gpp(NH)p was about 55% at 2 nM radioligand concentration irrespective of the magnesium concentration. The maximal effect of sodium ions was reduced by increasing concentrations of magnesium ions. Increasing magnesium ion concentration from 1 to 100 mM increased the half-maximally effective concentration of Gpp(NH)p almost 10-fold and that of sodium ions less than 2-fold. Furthermore, sodium ions and Gpp(NH)p had additive effects. The binding of an agonist to striatal A2a receptors shows an unusually large dependence on both divalent and monovalent cations that can only partly be explained by a change in the coupling to Gs proteins.

Adenosine↗
PubMed1992

Effect of the neurotoxin AF64A on intrinsic and extrinsic neuronal systems of rat neostriatum measured by in vivo microdialysis.

In the present in vivo microdialysis study the aziridinium ion of ethylcholine mustard, AF64A and the excitotoxin ibotenic acid were compared for their effects on extracellular striatal acetylcholine, choline, gamma-aminobutyric acid (GABA), dopamine and its metabolites, glutamate and aspartate, measured in the same perfusate sample, under basal and high KCL conditions. Ten days following unilateral striatal injections of AF64A (2 x 0.08 to 2 x 8 mM) there was a dose-dependent decrease in the extracellular striatal levels of acetylcholine and GABA, the two major intrinsic striatal neurotransmitter systems. No significant effects were observed on any of the monitored neurotransmitter systems following the lowest (2 x 0.08 mM) dose of AF64A, while at the intermediate (2 x 0.8 mM) dose, AF64A produced a unilateral > 50% and > 70% decrease in basal extracellular striatal acetylcholine and GABA levels respectively. The effects of K(+)-depolarization on extracellular acetylcholine and GABA levels were diminished by approximately 50%. At the highest dose (2 x 8 mM), extracellular striatal acetylcholine levels were non-detectable under basal conditions, while the GABA levels were decreased by > 50%, when compared with the contralateral intact side. However, at this dose, GABA levels were bilaterally decreased compared to levels observed in control animals. Basal extracellular striatal dopamine and glutamate levels, representing the two major extrinsic neurotransmitter systems innervating the neostriatum were only affected by the highest dose of AF64A. The excitotoxin ibotenic acid (2 x 28.4 mM) produced a strong unilateral decrease in extracellular striatal acetylcholine (> 80%) and GABA (> 90%) levels, without significantly affecting basal dopamine and glutamate levels.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1992

Trisomy 7 in nonneoplastic focal steatosis of the liver.

Cytogenetic analysis of short-term cultures of a nonneoplastic focal steatosis of the liver showed trisomy 7 as the sole chromosomal change. This finding, especially when viewed in light of previous reports describing +7 in nonneoplastic tissues, strongly suggests that trisomy 7 cannot be considered a tumor-specific abnormality when it occurs as the only change. The cell type in which +7 is present is not yet known.

Adult↗