Search PubMed⌕ Search

Biomedical subjects

B J Aronow

Publications and source records attributed to B J Aronow.

31 records · Page 2Linked to original sources
PubMed1994

Temporally and spatially restricted expression of apolipoprotein J in the developing heart defines discrete stages of valve morphogenesis.

During cardiac valve morphogenesis, a series of interactions between the mesodermal-derived myocardium and the overlying endothelium lead to condensed leaflet structure formation. At the atrioventricular (AV) canal, endocardial cells are transformed by specialized underlying myocardial cells into endocardial cushions, and then remodeled into mitral and tricuspid valves. Aortic and pulmonary valves develop by a similar mechanism in the primitive outflow tract. Few genes exhibit restricted spatiotemporal expression in these critical embryonic structures, thus limiting the clues to the sequence of molecular events necessary for valvulogenesis. Apolipoprotein J (ApoJ), a secreted glycoprotein expressed in a variety of cell types at tissue interfaces, exhibits a highly restricted and dynamic expression pattern in the developing heart. ApoJ transcripts were detected in mice at day 9.0 of gestation in the wall of the developing truncus arteriosus. By day 10, intense signal occurred in a thin layer of myocardial cells adjacent to developing endocardial cushions of both atrioventricular canal and truncus arteriosus. No apoJ mRNA was present in the overlying endocardial cushions until day 13.5 when prevalvular condensation begins. Intense expression occurred in the stromal connective tissue throughout leaflet formation. The highly restricted spatiotemporal expression pattern of apoJ in the developing heart implicates its role in the morphogenesis of the AV canal and outflow tract into cardiac valves.

Animals↗
PubMed1994

Mouse apolipoprotein J: characterization of a gene implicated in atherosclerosis.

Apolipoprotein J (apoJ), a glycoprotein associated with subclasses of plasma high density lipoproteins (HDL), was found to accumulate in aortic lesions in a human subject with transplantation-associated arteriosclerosis and in mice fed a high-fat atherogenic diet. Foam cells present in mouse aortic valve lesions expressed apoJ mRNA, suggesting local synthesis contributes to apoJ's localization in atherosclerotic plaque. As a prerequisite for elucidating the physiological function of apoJ by using a mouse model, cDNA clones representing the mouse homolog of apoJ were isolated, characterized, and sequenced. The nucleotide sequence predicts a 448 amino acid, 50,260 dalton protein. There was 81% nucleotide sequence similarity between mouse and human apoJ, and 75% similarity at the amino acid level. Mouse apoJ contains six potential N-glycosylation sites, a potential Arg-Ser cleavage site to generate alpha and beta subunits, a cluster of five cysteine residues in each subunit, three putative amphipathic helices, and four potential heparin-binding domains. Southern blot analysis indicates that the gene encompasses approximately 23 kb of DNA. Recombinant inbred strains were used to map apoJ to mouse chromosome 14, tightly linked to Mtv-11. All of the transcribed portions of the gene were cloned and analyzed, and all intron-exon boundaries were defined. The first of the 9 exons is untranslated. Single exons encode the signal peptide, the cysteine-rich domain in the alpha subunit, two potential amphipathic helices flanking a heparin-binding consensus sequence, and a potential amphipathic helix overlapping a heparin-binding domain, supporting their potential functional significance in apoJ. A variety of mouse tissues constitutively express a 1.9 kb apoJ mRNA, with apparently identical transcriptional start sites utilized in all tissues tested. ApoJ mRNA was most abundant in stomach, liver, brain, and testis, with intermediate levels in heart, ovary, and kidney. The high degree of similarity between mouse and human apoJ, in structure and distribution of the gene product, gene structure, and deposition in atherosclerotic plaques, suggests that the mouse is an ideal model with which to elucidate the role of apoJ in HDL metabolism and atherogenesis.

Amino Acid Sequence↗
PubMed1993

Apolipoprotein J expression at fluid-tissue interfaces: potential role in barrier cytoprotection.

Apolipoprotein J (apoJ) is a sulfated secreted glycoprotein that exhibits ubiquitous expression, evolutionary conservation, and diverse tissue inducibility. It has been proposed to have roles in programmed cell death, sperm maturation, complement regulation, and lipid transport. To identify cell types that synthesize apoJ and to aid evaluation of its function, we screened mouse and human tissues by in situ hybridization. ApoJ was expressed at high levels in an array of specialized cell types of adult and fetal mouse tissues and in similar cell types of human tissues. Most of these cell types are highly secretory and form the cellular interfaces of many fluid compartments. This group includes epithelial boundary cells of the esophagus, biliary ducts, gallbladder, urinary bladder, ureter, kidney distal convoluted tubules, gastric glands, Brunner's glands, choroid plexus, ependyma, ocular ciliary body, endometrium, cervix, vagina, testis, epididymus, and visceral yolk sac. Several nonepithelial secretory cell types that express high levels of apoJ also line fluid compartments, such as synovial lining cells and ovarian granulosa cells. In the context of its known biochemical properties, this expression pattern suggests that localized synthesis of apoJ serves to protect a variety of secretory, mucosal, and other barrier cells from surface-active components of the extracellular environment.

Animals↗
PubMed1993

Hepatocyte-specific expression of the mouse hepatocyte growth factor-like protein.

We have cloned and characterized the gene and complementary DNA for a new kringle-containing protein. Although the function of this protein is not known, it has been called hepatocyte growth factor-like protein because it shares the same structural domains as hepatocyte growth factor, with four kringle structures followed by a region homologous to serine proteases. To determine if hepatocyte growth factor-like protein is synthesized by the same cells as hepatocyte growth factor, we surveyed adult mouse and developing mouse embryo tissues by in situ hybridization analysis using radiolabeled RNA for hepatocyte growth factor-like protein. Results of in situ hybridization analysis of adult mouse tissues show that among all surveyed tissues specific signal was restricted to the liver. Higher magnification of liver sections shows that hepatocytes were the only cell type expressing messenger RNA for hepatocyte growth factor-like protein, contrary to the reported presence of hepatocyte growth factor messenger RNA in fat-storing cells. A similar liver-restricted and hepatocyte-specific pattern of messenger RNA expression was observed in the developing mouse embryo at 14 days of gestation. All other developing tissues that were analyzed, as well as liver hematopoietic cells, did not express messenger RNA for hepatocyte growth factor-like protein at levels detectable by this technique. We conclude that although structurally similar to hepatocyte growth factor, hepatocyte growth factor-like protein is a novel protein synthesized primarily in hepatocytes.

Animals↗
PubMed1993

Platelet activation releases megakaryocyte-synthesized apolipoprotein J, a highly abundant protein in atheromatous lesions.

Apolipoprotein J (apoJ) is an abundant glycoprotein in many biological fluids, and its constitutive high level synthesis is characteristic of many epithelial cells exposed to harsh fluids such as urine, bile, and gastric secretions. In addition, dramatic induction of apoJ occurs in cells surrounding several kinds of pathological lesions. Because platelets and circulating inflammatory cells represent critical elements in numerous pathological processes, we evaluated bone marrow cells for the presence of apoJ. Based upon messenger RNA in situ hybridization and immunofluorescent protein detection, high-level apoJ gene expression and protein accumulation occurred exclusively in mature megakaryocytes. Our results indicate that apoJ is stored in platelet granules and is released into extracellular fluid following platelet activation. Because atheromatous plaque development involves platelet aggregation and activation, we looked for and found abundant apoJ protein in advanced human atheromatous lesions. Thus, platelet sequestration and activation may lead to the rapid deployment of apoJ into sites of vascular injury. We hypothesize that platelet-derived apoJ participates in both short-term wound repair processes and chronic pathogenic processes at vascular interfaces.

Animals↗
PubMed1992

A novel murine homeobox gene isolated by a tissue specific PCR cloning strategy.

We have identified a novel homeobox gene, designated K-2, using a reverse transcription PCR cloning strategy. Sequence analysis reveals that the homeobox of K-2 is 77.6% homologous at the nucleotide level and 97% identical at the amino acid sequence level to another murine gene, S8. Homeodomain sequence comparisons indicate that K-2 and S8 represent a distinct subclass of paired type homeobox genes. Northern blot analysis of RNA from murine embryos and adult tissues identified multiple transcripts that are expressed in a developmentally specific and tissue restricted manner. Alternate splicing of K-2 at the 3-coding region leads to the inclusion of a chain terminating sequence. In addition, the developmental expression pattern of this gene at day 12 of gestation was determined by in situ hybridization. Expression was observed in diverse mesenchymal cells in craniofacial, pericardial, primitive dermal, prevertebral, and genital structures.

Alternative Splicing↗
PubMed1992

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine Deaminase↗
PubMed1991

Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts.

Using histochemical detection, we have visualized in situ the complete metabolic pathway for the degradation of purine nucleotides. From the tongue to the ileum, diverse epithelial cell types lining the lumen of the mouse gastrointestinal (GI) tract strongly coexpress each of the five key purine catabolic enzymes. Dramatic increases in the expression of each enzyme occurred during postnatal maturation of the GI tract. Using in situ hybridization, an intense accumulation of adenosine deaminase (ADA) mRNA was detected only within GI epithelial cells undergoing postmitotic differentiation. In a similar manner, at the developing maternal-fetal interface, high level expression of the purine catabolic pathway also occurred in a unique subset of maternal decidual cells previously known to express high levels of alkaline phosphatase and ADA. This induction occurred almost immediately after implantation in the periembryonic maternal decidual cells, shortly thereafter in antimesometrial decidual cells, and later in cells of the placental decidua basalis: all of which contain cell types thought to be undergoing programmed cell death. The expression of the pathway at the site of embryo implantation appears to be critical because its pharmacologic inhibition during pregnancy has been found to be embryolethal or teratogenic. Purine destruction at these nutritional interfaces (placenta and gastrointestinal tract) seem to override any potential economy of purine salvage, and may represent biochemical adaptation to nucleic acid breakdown occurring in the context of dietary digestion or extensive programmed cell death.

5'-Nucleotidase↗
PubMed1990

In vitro establishment and characterization of a human megakaryoblastic cell line.

A human megakaryoblastic cell line, designated CHRF-288-11, has been established in vitro through the use of adherent stromal cells in long-term human bone marrow culture. Long-term bone marrow cultures were required for the initial adaptation of the megakaryoblastic cells to culture conditions; however, once adapted, the cells were weaned from the stromal layer until they proliferated in the complete absence of any feeder layers. The seed cells for the establishment of this line were derived from a solid tumor; the cloned cell line derived from this tumor exhibits markers characteristic of megakaryocytes and platelets. Specifically, the cells express platelet peroxidase, platelet factor 4, and platelet Ca+(+)-adenosine triphosphatase (ATPase), glycoprotein IIb-IIIa (CDw41), factor VIII antigen, and the MY7 (CD13) and MY9 (CD33) antigens. The cells do not express the erythroid markers glycophorin A and hemoglobin, the myeloid marker myeloperoxidase, nor markers specific for T and/or B cells. The established cell line produces both basic fibroblast growth factor and transforming growth factor-beta, properties demonstrated previously for the solid tumor. The clonal cell population exhibited a unique, singular karyotype, indicating cellular homogeneity. The cells display a doubling time of approximately 33 hours in either 25% horse or calf serum. Treatment of the cells with 1 X 10(-8) mol/L phorbol 12-myristate 13-acetate (PMA) leads to the induction of multi-nucleation and hyperploidy in the cells, with approximately 35% of the cells exhibiting two or more nuclei per cell, and greater than 80% of the cells enlarging in size. The establishment of this unique cell line under defined culture conditions will be beneficial for the future study of megakaryocytic properties expressed by this cell line.

Blotting, Northern↗
PubMed1976

Myosin-paramyosin cofilaments: enzymatic interactions with F-actin.

The interaction between paramyosin and myosin has been studied by enzymological methods. Clam adductor paramyosin inhibits the actin-activated, Mg2+-requiring ATPase of both clam adductor and rabbit skeletal muscle myosins. Myosin and paramyosin must be rapidly coprecipitated for this inhibition. Incubation with F-actin in the absence of ATP does not alter this effect. This inhibition follows a hyperbolic function with respect to paramyosin concentration. Slow precipitation by dialysis of myosin and paramyosin together leads to copolymers with actin-activated ATPase equivalent to that of slowly formed myosin filaments. Both kinds of slowly formed filaments have enzymatic properties distinct from those of the rapidly precipitated proteins. Paramyosin is competitive with F-actin for their effects upon myosin. The apparent affinity of myosin for F-actin is markedly reduced by association with paramyosin, but the extrapolated maximal velocity of actomyosin is unaffected. The specificity of this inhibition is strongly suggested by marked quantitative differences between native and cleaved paramyosins. No inhibition of intrinsic myosin ATPase by paramyosin is seen. These studies suggest that at least two types of condition-dependent association between myosin and paramyosin are possible. One class of interactions is associated with enzymic inhibition in rapidly coprecipitated filaments, whereas slowly formed cofilaments exhibit catalytic activity similar to that of identically treat-d myosin and have a characteristic 14.5 nm axial repeat.

Actins↗
PubMed1975

Interaction of myosin and paramyosin.

The interaction of myosin and paramyosin was investigated by enzymological and ultrastructural techniques. The actin-activated Mg+2 ATPase of rabbit skeletal muscle myosin can be inhibited by clam adductor paramyosin. Both proteins must be rapidly coprecipitated to form filaments for this inhibition. Slowly formed cofilaments are fully activatable by F-actin. In both cases, the cofilaments possess unique structural characteristics when compared to homofilaments. The mode of inhibition appears to be competitive when different concentrations of paramyosin and F-actin are compared. The apparent affinity of the myosin heads for actin is reduced by the presence of paramyosin within rapidly reconstituted thick filaments. These results suggest that paramyosin may serve as part of a relaxing mechanism within invertebrate muscles. It is unlikely that paramyosin plays a role in the initiation and maintenance of catch within specialized molluscan muscles.

Actins↗
PubMedDate not supplied

Understanding cardiac development through the perspective of gene regulation and gene manipulation.

Cardiovascular malformations affect about 1% of newborns, yet much remains to be learned about the pathogenesis of these defects. Advances in understanding some of the molecular events involved in regulating cardiac morphogenesis are providing a new perspective with which to approach complex issues and questions related to congenital heart disease. More important, this new information provides not only unique opportunities for developing specific experimental models of congenital heart disease through direct genetic manipulation but also the basis for developing ways of therapeutically manipulating cardiac gene expression for some form of heart disease. This review presents recent advances in the understanding of the molecular aspects of cardiac development and how this information can be used to manipulate cardiac gene expression during development.

Animals↗