Biomedical subjects
Publications and source records attributed to A Vandenberghe.
The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).
An antigen prepared in Australia and antisera collected from cattle having had field infections of babesiosis were taken to Mozambique for a serological comparison of strains of babesia bovis from the 2 countries. The reactivity of antisera collected in Mozambique against the Australian antigen was similar to that of the imported antisera. This suggested a close serological relationship between b. bovis of the 2 countries. The practical implication of this finding is that Australian vaccine should protect cattle being introduced into southern Africa from B. bovis-free environments.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
32P-Labeled MS2 RNA was partially digested with ribonuclease T1 (guanyloribonuclease; ribonucleate 3'-guanylo-oligonucleotidohydrolase; EC 3.1.4.8) or with epilson-carboxymethyl-lysine-41 pancreatic ribonuclease A (ribonucleate 3'-pyrimidino-oligonucleotidohydrolase; EC 3.1.4.22). A series of overlapping fragments was obtained which allowed the reconstruction of a 361-nucleotide-long 3'-terminal sequence. A unique reading frame could be deduced, which indicated that the replicase gene ends with a U-A-G termination signal and is followed by a 174-nucleotide-long untranslated segment.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
RNA fragments of different chain length, each containing the 5'-terminal guanosine tetraphosphate (pppGp) of bacteriophage-MS2 RNA, have been isolated from partial ribonuclease digests of the viral RNA. The longest fragment overlaps with the ribosomalbinding site of the A-protein cistron. The base sequence has been established for the major part. The results directly confirm that the A-protein cistron is closest to the 5'-terminus. Its initiating (AUG) codon starts at position 130, being preceded by an untranslated sequence of 129 nucleotides.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
The gene coding for the amyloid protein, a component of neuritic plaques found in brain tissue from patients with Alzheimer's disease, has been localized to chromosome 21, and neighbouring polymorphic DNA markers segregate with Alzheimer's disease in several large families. These data, and the association of Alzheimer's disease with Down's syndrome, suggest that overproduction of the amyloid protein, or production of an abnormal variant of the protein, may be the underlying pathological change causing Alzheimer's disease. We have identified a restriction fragment length polymorphism of the A4-amyloid gene, and find recombinants in two Alzheimer's disease families between Alzheimer's disease and the A4-amyloid locus. This demonstrates that the gene for plaque core A4-amyloid cannot be the locus of a defect causing Alzheimer's disease in these families. These data indicate that alterations in the plaque core amyloid gene cannot explain the molecular pathology for all cases of Alzheimer's disease.
Duchenne muscular dystrophy (DMD) is a severe X-linked neuromuscular disease with an incidence of approximately 1 in 3,500 newborn boys. The DMD locus has a high mutation frequency: one third of the cases is thought to result from a new mutation. Linkage studies using probes to detect restriction fragment length polymorphisms and DNA deletion studies have greatly improved DMD carrier detection and prenatal diagnosis. Here we report on two families in which a pERT87 (DXS164) deletion was transmitted to more than one offspring by women who showed no evidence for the mutation in their own somatic (white blood) cells. We also show that the deletion in both siblings in one of the families is identical, indicating that the deletion must have occurred during mitosis in early germline proliferation, leading to a germline mosaicism. This phenomenon may turn out to be a major factor contributing to the induction of DMD mutations, and has important implications for the counselling of DMD families.