Biomedical subjects

A Saxena

Publications and source records attributed to A Saxena.

At least 73 records · Page 4Linked to original sources

PubMed2001

Subaortic membrane excision: mid-term results.

BACKGROUND: Subaortic membrane (SAM) is a form of fixed subaortic obstruction in which a fibrous membrane is located below the aortic valve. AIM: To determine the role of surgical treatment for patients with a discrete SAM. PATIENTS AND METHODS: The hospital records of 45 patients (age range: 2-23 years; median 8 years) undergoing surgery for SAM between 1990 and 1998 at the All India Institute of Medical Sciences, New Delhi, India, were analysed. Preoperative echocardiographically calculated gradients across the left ventricular outflow tract ranged from 50 to 154 mmHg (mean: 86.5 +/- 33.2 mmHg). Nine patients had trivial aortic regurgitation (AR), 10 had mild AR and five had moderate-severe AR. The left ventricular ejection fraction (LVEF) ranged from 20 to 68% (mean 48 +/- 15%). Nineteen patients had significant left ventricular dysfunction (LVEF <50%). Transaortic resection of SAM was done in all patients along with excision of a wedge-shaped segment of septal muscle underlying the membrane. RESULTS: There were no early or late postoperative deaths. On follow up (up to 113 months), only four patients had gradients >30 mmHg. LVEF improved to 45-70% (mean 58 +/- 7.7%). AR reduced to mild in four patients and trivial in four patients, and did not progress further. CONCLUSION: Resection of SAM carries long-term benefits. Routine septal myectomy appears to be associated with a low risk of recurrence.

Journal Article↗

PubMed2001

A modified technique of devascularization for surgical management of portal hypertension in children.

In developing countries surgery is indicated in patients with portal hypertension for a variety of reasons. This study prospectively evaluates a modified technique of devascularization for secondary prophylaxis of variceal bleeding in patients with portal hypertension of different aetiologies. Transabdominal extensive oesophagogastric devascularization combined with transmural ligation of oesophageal and gastric varices was performed in 16 paediatric patients (nine with extrahepatic portal venous obstruction, and seven with non-cirrhotic portal fibrosis) in an elective setting. The Sugiura devascularization procedure was modified to minimize the operating time and to avoid the problems associated with oesophageal transection and anastomosis. The operative mortality rate as well as the oesophageal leak rate was zero. One patient developed an oesophageal stricture. During a 12-month follow-up, patients were seen with residual varices (2), recurrent varices (3) and rebleeding (1). Porto-systemic encephalopathy was seen in one patient only. This technique is a simple, straightforward, safe and effective modification of the Sugiura procedure in controlling bleeding, providing good quality of life with minimal porto-systemic encephalopathy.

Child↗

PubMed2001

Tramadol for postoperative shivering: a double-blind comparison with pethidine.

In most operating and recovery rooms, shivering is controlled by the use of humidifiers, warming blankets, and inhalation of humidified heated oxygen. However, pharmacological control is an effective alternate treatment modality. This randomized, double-blind trial, conducted in 30 ASA Grade 1 or 2 patients, was designed to explore the efficacy of tramadol and pethidine in the treatment of post-anaesthetic shivering. Tramadol is an inhibitor of the re-uptake of serotonin (5-hydroxytryptamine) and norepinephrine in the spinal cord. This facilitates 5-hydroxytryptamine release, which influences thermoregulatory control. We compared the efficacy of tramadol with that of pethidine, presently a widely used drug for the control of shivering. Patients received either tramadol 1 mg/kg or pethidine 0.5 mg/kg intravenously and the grade of shivering, pulse rate, blood pressure and respiratory rate were observed every 10 minutes after injection for one hour Shivering was significantly more likely to have ceased in the tramadol group (12 of 15 versus 4 of 15 cases, P<0.05) at 10 minutes after drug administration and this control was better sustained. No patients receiving tramadol had a recurrence of shivering. It is concluded that intravenous tramadol 1 mg/kg is more effective for the treatment of postoperative shivering than pethidine 0.5 mg/kg.

Adult↗

PubMed2001

Proximal fourth metatarsal injuries in athletes: similarity to proximal fifth metatarsal injury.

Proximal fourth metatarsal injuries are rarely reported. We present five case histories in which athletic patients sustained injuries at the shaft-base junction of the fourth metatarsal. Similar to proximal fifth metatarsal injuries, adduction of the forefoot appears to be associated. Our patients returned to their activities in two to eight months. These patients injuries tended to take longer to heal than other lesser metatarsal fractures and stress fractures (which are typically more distal). Some patients were continually symptomatic, even after three months of rest and immobilization. This coincides with proximal fifth metatarsal injuries and stress fractures. For treatment of proximal fourth metatarsal injuries to be successful, ideal treatment appears to involve nonweightbearing below-knee cast/boot immobilization for three weeks. This is followed by an additional three or more weeks of weightbearing immobilization. Healing may still be prolonged.

Adolescent↗

PubMed2001

Goblet cell carcinoids of the appendix: immunophenotype and ultrastructural study.

BACKGROUND: Goblet cell carcinoids of the appendix are rare neoplasms with uncertain biological behavior. OBJECTIVE: The aims of our study were to evaluate the immunophenotype of this neoplasm with cell cycle/cell proliferation markers and to understand their histogenesis with ultrastructural analysis using conventional carcinoids as a frame of reference. METHODS: Clinical data and archival pathologic material of all goblet cell carcinoids of the appendix recorded by the Saskatchewan Cancer Registry between 1970 and 1998 were reviewed and evaluated by light microscopy, histochemistry, immunohistochemistry, and electron microscopy. RESULTS: Seven cases of goblet cell carcinoids were identified among 110 cases of conventional carcinoids of the appendix. Histopathology revealed widespread infiltration of the periappendiceal fat in all cases, with extensive perineural invasion. The cells stained strongly positive for mucicarmine, periodic acid-Schiff, periodic acid-Schiff diastase, Alcian blue, cytokeratin, and carcinoembryonic antigen. Most cases were positive for synaptophysin. Increased expression of cell proliferation markers and cell cycle markers was observed. Expression of p53 was strong in one case. Electron microscopy demonstrated the presence of mucinous vacuoles of varying sizes and occasional membrane-bound neuroendocrine granules. CONCLUSIONS: Goblet cell carcinoids of the appendix arise from a pluripotent cell with divergent neuroendocrine and mucinous differentiation. These neoplasms are widely invasive; they demonstrate a high cellular proliferation rate and dysregulation of the cell cycle with up-regulation of cyclin D1 and p21, and down-regulation of p16. Complete removal of the tumor is recommended because of the unpredictable biological behavior of this tumor, which includes delayed local recurrences and lung metastases.

Adult↗

PubMed2001

Mitral valve repair in a predominantly rheumatic population. Long-term results.

Valve repair in rheumatic patients poses special problems due to valve deformity and mixed lesions. We present our experience from January 1988 through June 1999, in this retrospective study of 818 patients (377 males). The mean age was 22.8 +/- 11.3 years (range, 2 to 70 years). The cause of mitral regurgitation was rheumatic in 718 (88%) patients, congenital in 51, myxomatous in 34, infective in 7, and ischemic in 8. Most patients (64%) were in New York Heart Association functional class III or IV. Congestive heart failure was present in 116 patients (14%). Reparative procedures included posterior collar annuloplasty (n=710), commissurotomy (n=482), cusp-level chordal shortening (n=237), cusp thinning (n=222), cleft suture (n= 166), and cusp excision/plication (n=42). Operative mortality was 4% (32 patients). Preoperative left ventricular dysfunction, presence of congestive heart failure, and advanced functional class were associated with greater mortality. Follow-up ranged from 1 to 144 months (mean, 44.9 +/- 33.2 months) and was 96% complete. Most survivors (70%) had no or trivial mitral regurgitation. Forty patients required reoperation for valve dysfunction. There were 23 (2.8%) late deaths. Actuarial, reoperation-free, and event-free survival at 11 years were 92.6% +/- 1.0%, 65.0% +/- 10%, and 38% +/- 6.0%, respectively Among the survivors, 85% were in New York Heart Association functional class I. We conclude that mitral valve repair in rheumatic patients, using current techniques, can effectively correct hemodynamic and functional abnormalities with satisfactory results.

Adolescent↗

PubMed2001

Pushing the envelope. Case studies on how fast you can and cannot return the elite athlete to running.

When treating an elite athlete, a physician always must keep in mind the status of the athlete in training, upcoming sports events, and the athlete's financial status. If the treatment requires the athlete to withdraw from regular training or sports events, a modified training program should be considered. This modified training must be balanced with returning the athlete back to full form and keeping him or her physically fit.

Adolescent↗

PubMed2001

Physical growth assessment in adolescence.

OBJECTIVE: To describe ponderosity indices body mass index--"BMI" and ponderal index "PI" and skin fold thicknesses (triceps, biceps, subscapular and suprailiac) for affluent Indian school going adolescents. DESIGN: Cross sectional. METHODS: Measurements were recorded in healthy affluent school going adolescents in public schools of 12 cities in India (boys=11,863 and girls 7,694). Means and percentiles of ponderosity indices and skinfold thicknesses at yearly intervals were derived for each sex and related to sexual maturity. RESULTS: BMI, PI and skin fold thickness (SFT) were higher in girls. There was lower variability of these parameters with sexual maturity rating (breast/genital development stages) as compared to age, suggesting use of these indices in relation to sexual maturity for assessment of adolescent growth. CONCLUSION: Pediatricians and endocrinologists can use these indices for assessment of thinness and obesity, in adolescent Indian children, in relation to sexual maturity for the age.

Adolescent↗

PubMed2000

Synthesis, chiral chromatographic separation, and biological activities of the enantiomers of 10,10-dimethylhuperzine A.

(+/-)-10,10-Dimethylhuperzine A (2, DMHA) has been synthesized, and its enantiomers have been separated using chiral HPLC. (-)-DMHA inhibits AChE with a Ki value approaching that of (-)-huperzine A, whereas (+)-DMHA shows no AChE inhibitory activity. On the other hand, both enantiomers are equally potent against glutamate-induced neurotoxicity when tested in neurons.

Acetylcholine↗

PubMed2000

Association between mutations of the follicle-stimulating-hormone receptor and repeated twinning.

Follicle-stimulating hormone (FSH) has a role in folliculogenesis and spontaneous twinning. Using the candidate gene approach, we searched for mutations in the gene encoding the FSH receptor in a woman who had given birth to two sets of dizygotic twins without fertility treatment. We identified two linked mutations (Thr307Ala and Asn680Ser) that were closely associated with this phenotype. We suggest that expression of both mutations increases the sensitivity of the receptor to FSH.

Adenine↗

PubMed2000

Anomalous colloidal stability of protein coated polystyrene latex beads studied by small angle light scattering.

Results of small angle laser light scattering experiments carried out on polystyrene latex beads coated with lysate of Plasmodium falciparum (Pf) antigen (Ag) and human seropositive sera (10:1 ratio) are reported for various NaCl concentrations (0-300 mM). The protein coated beads showed time-dependent coagulation. The normalised intensity of scattered light I(s)(t)/I(0) showed I(s)(t)/I(0)=1+(Gammat)(delta) behaviour with the coagulation rate, Gamma and exponent, delta showing anomalous dependence on NaCl concentration. The coagulation rate exhibited strong increase up to NaCl concentration of 50 mM, above this and up to 300 mM the coagulation rate was found to remain independent of NaCl concentration yielding non-DLVO behaviour. The same was true for delta which increased from 1.04+/-0.06 to 6.94+/-0.07 as NaCl concentration was raised from 0 to 50 mM. Above 50 mM it remained constant with delta=6.94+/-0.07. Results are discussed through Smoluchowski aggregation kinetics and theoretical construction of interparticle interaction potentials relevant to our problem.

Animals↗

PubMed2000

Molecular geometry fluctuation model for the mobility of conjugated polymers.

We present a model to describe electrical transport in dense films of conjugated polymers. The essential physical features of the model are as follows: (i) thermal fluctuations in the molecular geometry of the polymer modify the energy levels of localized electronic states in the material, and (ii) the primary restoring force for these fluctuations is steric, which leads to spatial correlation in the energies of the localized electronic states. The model describes the electric field dependence of the mobility and explains the carrier density dependences of mobility observed in polymer diodes and field effect transistors.

Journal Article↗

PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗

PubMed2000

Distinct B-cell clonal bands in Helicobacter pylori gastritis with lymphoid hyperplasia.

Helicobacter pylori (Hp)-associated gastritis is a risk factor for gastric mucosa-associated lymphoid tissue (MALT) lymphoma. Clonal B-cell populations are present in both reactive and neoplastic MALT tissue, thus limiting their usefulness in the evaluation of gastric lymphoid infiltrates in endoscopic biopsy specimens. The aim of this study was to identify the presence of clonal B-cell populations in Hp-gastritis with MALT and to assess their usefulness in distinguishing reactive from malignant infiltrates. Routinely fixed paraffin-embedded blocks from 20 patients with Hp-gastritis with lymphoid hyperplasia were analysed for B-cell clonality by a semi-nested polymerase chain reaction (PCR) using FRIII/LJH and FRIII/VLJH primers for amplification of the VDJ region of the immunoglobulin heavy chain gene. The histopathological findings were evaluated according to a previously published scoring system. Immunohistochemistry was performed by the labelled streptavidin-biotin technique using the following primary antibodies: CD45, CD45RO, CD3, CD20, and cytokeratin. The histopathological findings were diagnostic of Hp-chronic active gastritis (grade 2, n=17; grade 3, n=3). Scattered intraepithelial B-cells were present in all cases and non-destructive lymphoepithelial lesions in one grade 3 case. Amplifiable DNA was obtained from all samples. Clonal bands were observed in ten (7/17 grade 2 and 3/3 grade 3 lesions) and polyclonal smears in ten cases (all grade 2). The clonal bands were often (n=6) associated with a background polyclonal smear and were not reproducible from deeper sections (n=10) or another paraffin block (n=1), while the clonal bands in control low-grade MALT lymphomas were not associated with a background smear and were reproducible from deeper sections. None of the patients has developed lymphoma to date (follow-up 21-44 months). In conclusion, B-cell clonal bands are common in H. pylori-gastritis with lymphoid hyperplasia. The irreproducibility of these bands is a useful feature in favouring a reactive process.

Adult↗

PubMed2000

Percutaneous transluminal angioplasty of the aorta in children with nonspecific aortoarteritis: acute and follow-up results with special emphasis on left ventricular function.

Nonspecific aortoarteritis (NSAA) is a chronic disease of unknown etiology and may result in stenosing and obstructive lesions of the aorta. Transluminal balloon angioplasty was carried out in 17 children, 4-12 years of age (mean 8.9 +/- 2.7 years) with symptomatic stenosis of thoracic or abdominal aorta due to NSAA. Hypertension was present in 15 children, and 11 had significant left ventricular dysfunction. All children had a clinically inactive disease. The stenosis was in descending thoracic aorta in 10, thoracoabdominal in 3 and only abdominal in 4. Symptomatic improvement with relief of stenosis was seen in 16 of 17 children, although in 3, the results were suboptimal. The peak systolic gradient fell from 70.9 +/- 19.3 mmHg to 32.0 +/- 19.2 mmHg immediately after dilation (P < 0.0001). Angiographically measured luminal diameter stenosis also fell from 82.5 +/- 7.7% to 19.4 +/- 11.8% (P < 0.0001). Dissection flap was seen in 13 cases. It was large in cases with long, diffuse and eccentric stenosis of the thoracic or thoracoabdominal aorta. On follow-up (available for 14 of 16 cases for a period of 2-87 months mean 20.7 +/- 21.5 months, median 15.5 months) two patients developed restenosis. Left ventricular function improved in all 8 children that had sustained benefit of angioplasty. Blood pressure normalized in 9 of 13 children and the drug requirements fell in 4 others. Further remodeling of the lesion with decrease in gradients and luminal stenosis was observed in 11 children that have been restudied. Balloon angioplasty of aorta in children with NSAA is a feasible and safe procedure. Small intimal flap is seen in the majority, extensive dissection is more likely in the long diffuse lesions in descending thoracic aorta. Hypertension and left ventricular dysfunction improve after relief of obstruction.

Angioplasty, Balloon↗

PubMed2000

Congenital severe aortic stenosis with congestive heart failure in late childhood and adolescence: effect on left ventricular function after balloon valvuloplasty.

Left ventricular (LV) dysfunction with congestive heart failure (CHF) resulting from severe congenital aortic stenosis (AS) is a well-described condition in infancy, but it is rarely found in older children and adolescents. Aortic valve surgery in such cases may be associated with higher rates of morbidity and mortality. Aortic valve balloon dilatation (AVBD) is a viable alternative, but its effect on LV function has not been evaluated. We describe follow-up results of AVBD in 10 cases of severe congenital AS in older children and adolescents with CHF and LV dysfunction. The ages of these patients ranged from 5 to 18 yr (mean +/- SD: 10.8 +/- 4 yr), and nine were males. The follow-up period after AVBD ranged from 3 mo to 7 yr (mean +/- SD: 2.93 +/- 2.1 yr). Success was achieved in all cases, with no immediate complications. After valvuloplasty, the peak-to-peak systolic gradient declined from 74.7 +/- 30.8 to 33.9 +/- 18.2 mm Hg (P < 0.0001). The cardiac index increased slightly but significantly, from 1.9 +/- 0.27 to 2.2 +/- 0.5 L/min/m(2) (P < 0.015). Hemodynamic improvement was also confirmed by a significant decrease in mean pulmonary artery and pulmonary artery wedge pressures from 41.9 +/- 9 to 32.6 +/- 6.6 and from 25.5 +/- 2.9 to 19.3 +/- 3.4 mm Hg, respectively. The echocardiographically derived left ventricular ejection fraction (LVEF) improved from 21.6 +/- 5. 37% to 31 +/- 6.5% within 24 hr after AVBD, and it further improved in all cases on follow-up. Mean LVEF at last follow-up was 59.4 +/- 11.4%. The Doppler instantaneous peak systolic gradient (IPSG) increased from 37.3 +/- 18.8 to 64.8 +/- 30.7 mm Hg at late follow-up. Significant aortic regurgitation (AR) developed in 20% of patients. The Doppler IPSG across the aortic valve was > 60 mm Hg in five cases on follow-up. Two of these patients underwent another AVBD successfully 4 and 16 mo later, respectively. Aortic valve replacement was done in two patients, one for severe restenosis with mild AR 12 mo after AVBD and another for severe re-restenosis with moderate AR 21 mo after a second AVBD. Severe congenital AS can be associated with LV dysfunction and CHF in late childhood and adolescence. AVBD results in good palliation with improvement in LV function on follow-up.

Adolescent↗

PubMed2000

Multiple, closely spaced alternative 5' exons in the DmCKIIbeta gene of Drosophila melanogaster.

Drosophila melanogaster casein kinase II (CKII) is composed of catalytic alpha and regulatory beta subunits. Using the two-hybrid system, we have isolated a number of cDNAs that are related to a previously published cDNA encoding the beta subunit, but exhibit divergent 5' sequences. To determine the source of this sequence variation, we have isolated the gene encoding the beta subunit of CKII. The beta gene contains five exons encompassing the complete open reading frame, as well as five alternative exons in the 5' untranslated region (UTR). Only one 5' UTR exon is contained in each cDNA, implying five distinct classes of transcript. In addition, the beta gene contains at least two poly(A) addition signals which generate additional complexity at the 3' end. The complex pattern of transcription may serve a role in the spatial and/or temporal expression of the beta subunit since, with one exception, all transcripts encode the full-length beta polypeptide. Phylogenetic comparison of the beta genes of Drosophila, C. elegans, and mammals reveals three invariant introns as well as evidence of recent intron gain/loss.

Amino Acid Sequence↗

PubMed2000

Linear catch-up growth.

Chronic diseases and malnutrition cause growth failure in childhood and adolescence. Correction of the cause of a growth deficiency is usually followed by catch-up growth. Capacity to catch-up is not only variable in different phases of growth, it is also different in different diseases and among different individuals suffering from the same disease. Catch-up growth is of three types. In type 1 catch-up growth, height deficit is swiftly eliminated after the growth restriction ceases. In type 2, after growth restriction ceases growth continues for longer than usual and growth arrest is compensated. Type 3 is a mixture of type 1 and type 2. Repeated episodes of growth inhibitory conditions result in lower catch-up rates in the subsequent periods. Although the exact mechanism regulating catch-up growth still remains a mystery, monitoring catch-up growth remains an important measure of the efficacy of the therapy and therefore of immense clinical importance.

Adolescent↗