Search PubMed⌕ Search

Biomedical subjects

A Saha

Publications and source records attributed to A Saha.

At least 37 records · Page 2Linked to original sources
PubMed2004

Transforming growth factor-beta1 genotype in sporadic breast cancer patients from India: status of enhancer, promoter, 5'-untranslated-region and exon-1 polymorphisms.

Transforming growth factor beta (TGF-beta) is an example for a large and still-growing family of growth factors. TGF-beta1 is known to act both as a tumour suppressor and as a stimulator of tumour progression. This study examines the relationship amongst putative enhancer, promoter, 5'-untranslated-region (UTR) and exon-1 polymorphisms of the TGF-beta1 gene (region I from -1881 to -1613; region II from -1410 to -1123, and region III from -55 to +176, as per human genome organisation (HUGO) nomenclature) in 26 breast cancer patients and 97 healthy control subjects. The germline and somatic status of the four known polymorphisms was ascertained, and a significant difference was observed for the germline C/T and T/T genotype distribution between patients and controls in comparison to C/C genotypes at position -1349 (chi2 = 6.193; P = 0.009). In addition to the somatic variations observed for some of the regions studied, in 10/26 (38%) sporadic breast cancer cases, a novel somatic mutation in codon 47 of exon 1 (GenBank accession number AY059373) was also detected in tumour samples. The risk of cancer was found to be significant (OR = 4.525) for the -1349 C/T and T/T genotype background, suggesting that this genetic background may act as a risk factor for sporadic breast cancer.

5' Untranslated Regions↗
PubMed2004

Erosion of nails following thallium poisoning: a case report.

This case report describes a patient with thallium poisoning caused by repeated exposure to low doses of thallium. Alopecia and nail changes were the most prominent features of this case. There was dystrophy of nails in the form of whitish lunular stripes. This is the first report of complete erosion of proximal parts of nails following thallium poisoning. This case is the first report of thallium poisoning from India occurring from repeated low dose exposure.

Adult↗
PubMed2003

Polarization transfer in the 4He(e-->,e'p-->)3H reaction up to Q2=2.6 (GeV/c)2.

We have measured the proton recoil polarization in the 4He(e-->,e(')p-->)4H reaction at Q(2)=0.5, 1.0, 1.6, and 2.6 (GeV/c)(2). The measured ratio of polarization transfer coefficients differs from a fully relativistic calculation, favoring the inclusion of a medium modification of the proton form factors predicted by a quark-meson coupling model. In addition, the measured induced polarizations agree reasonably well with the fully relativistic calculation indicating that the treatment of final-state interactions is under control.

Journal Article↗
PubMed2003

Cross-section measurement of charged-pion photoproduction from hydrogen and deuterium.

We have measured the differential cross section for the gamman-->pi(-)p and gammap-->pi(+)n reactions at theta(c.m.)=90 degrees in the photon energy range from 1.1 to 5.5 GeV at Jefferson Lab (JLab). The data at E(gamma) greater, similar 3.3 GeV exhibit a global scaling behavior for both pi(-) and pi(+) photoproduction, consistent with the constituent counting rule and the existing pi(+) photoproduction data. Possible oscillations around the scaling value are suggested by these new data. The data show enhancement in the scaled cross section at a center-of-mass energy near 2.2 GeV. The cross section ratio of exclusive pi(-) to pi(+) photoproduction at high energy is consistent with the prediction based on one-hard-gluon-exchange diagrams.

Journal Article↗
PubMed2003

Two novel somatic mutations in the human interleukin 6 promoter region in a patient with sporadic breast cancer.

Two new single nucleotide mutations were observed within the promoter region of human interleukin-6 gene (IL-6) in the tumour sample of a patient with sporadic breast cancer, which was a somatic change. Both mutations, one at -125 (C > G) and the other at position -173 (G > T) from the translation start site, were transversions observed at new positions, not reported earlier. In addition to these two novel mutations in this patient, a known somatic polymorphism was also observed at position -174 (G > C) (from the transcription initiation site, redesignated as -236 from the translational initiation site as per the HUGO nomenclature). Further, a preliminary comparative analysis of the studied promoter region by the 'ConsInspector 3.0' program, where the mutated sequence (AF362378) was compared with the sequence existing in the database (Y00081), depicted the presence of the variations in putative binding sites for transcription factors such as glucocorticoid response element (GRE) and nuclear factor kappa-B (NFkappa-B), which could lead to differential expression of this gene.

Base Sequence↗
PubMed2002

Q2 evolution of the generalized Gerasimov-Drell-Hearn integral for the neutron using a 3He target.

We present data on the inclusive scattering of polarized electrons from a polarized 3He target at energies from 0.862 to 5.06 GeV, obtained at a scattering angle of 15.5 degrees. Our data include measurements from the quasielastic peak, through the nucleon resonance region, and beyond, and were used to determine the virtual photon cross-section difference sigma(1/2)-sigma(3/2). We extract the extended Gerasimov-Drell-Hearn integral for the neutron in the range of four-momentum transfer squared Q2 of 0.1-0.9 GeV2.

Journal Article↗
PubMed2002

2H(e,e(')p)n reaction at high recoil momenta.

The 2H(e,e(')p)n cross section was measured in Hall A of the Thomas Jefferson National Accelerator Facility near the top of the quasielastic peak (x(Bj)=0.964) at a four-momentum transfer squared, Q(2)=0.665 (GeV/c) (2) (omega=0.368 GeV, W=2.057 GeV), and for recoil momenta up to 550 MeV/c. The measured cross section deviates by 1-2sigma from a state-of-the-art calculation at low recoil momenta. At high recoil momenta the cross section is well described by the same calculation; however, in this region, final-state interactions and interaction currents are predicted to be large, and alternative choices of nucleon-nucleon potential and nucleon current operator may result in significant spread in the calculations.

Journal Article↗
PubMed2002

Measurement of G(E(p))/G(M(p)) in e(-->)p---> e(-->)p to Q(2) = 5.6 GeV(2).

The ratio of the electric and magnetic form factors of the proton G(E(p))/G(M(p)), which is an image of its charge and magnetization distributions, was measured at the Thomas Jefferson National Accelerator Facility (JLab) using the recoil polarization technique. The ratio of the form factors is directly proportional to the ratio of the transverse to longitudinal components of the polarization of the recoil proton in the elastic e(-->)p---> e(-->)p reaction. The new data presented span the range 3.5< Q(2)< 5.6 GeV(2) and are well described by a linear Q(2) fit. Also, the ratio sqrt[Q(2)] F(2(p))/F(1(p)) reaches a constant value above Q(2) = 2 GeV(2).

Journal Article↗
PubMed2001

Precision measurement of the spin-dependent asymmetry in the threshold region of 3He(e, e').

We present the first precision measurement of the spin-dependent asymmetry in the threshold region of 3He(e,e') at Q2 values of 0.1 and 0.2 (GeV/c)2. The agreement between the data and nonrelativistic Faddeev calculations which include both final-state interactions and meson-exchange current effects is very good at Q2 = 0.1 (GeV/c)2, while a small discrepancy at Q2 = 0.2 (GeV/c)2 is observed.

Journal Article↗
PubMed2001

Measurement of the high energy two-body deuteron photodisintegration differential cross section.

The first measurements of the d(gamma,p)n differential cross section at forward angles and photon energies above 4 GeV were performed at the Thomas Jefferson National Accelerator Facility (JLab). The results indicate evidence of an angular dependent scaling threshold. Results at straight theta(cm) = 37 degrees are consistent with the constituent counting rules for E(gamma) greater, similar 4 GeV, while those at 70 degrees are consistent with the constituent counting rules for E(gamma) greater, similar 1.5 GeV.

Journal Article↗
PubMed2001

Polarization measurements in high-energy deuteron photodisintegration.

We present measurements of the recoil proton polarization for the d(gamma-->,p-->)n reaction at straight theta(c.m.) = 90 degrees for photon energies up to 2.4 GeV. These are the first data in this reaction for polarization transfer with circularly polarized photons. The induced polarization p(y) vanishes above 1 GeV, contrary to meson-baryon model expectations, in which resonances lead to large polarizations. However, the polarization transfer Cx does not vanish above 1 GeV, inconsistent with hadron helicity conservation. Thus, we show that the scaling behavior observed in the d(gamma,p)n cross sections is not a result of perturbative QCD. These data should provide important tests of new nonperturbative calculations in the intermediate energy regime.

Journal Article↗
PubMed2000

Dynamical relativistic effects in quasielastic 1p-shell proton knockout from 16O

We have measured the cross section for quasielastic 1p-shell proton knockout in the 16O(e,e(')p) reaction at omega = 0.439 GeV and Q2 = 0.8 (GeV/c)(2) for missing momentum P(miss)</=355 MeV/c. We have extracted the response functions R(L+TT), R(T), R(LT), and the left-right asymmetry, A(LT), for the 1p(1/2) and the 1p(3/2) states. The data are well described by relativistic distorted wave impulse approximation calculations. At large P(miss), the structure observed in A(LT) indicates the existence of dynamical relativistic effects.

Journal Article↗
PubMed2000

Evaluation of intramolecular equilibria in complexes formed between substituted imidazole ligands and nickel (II), copper (II) or zinc (II).

The metal ion-binding properties of imidazole-4-acetate (ImA-), 4(5)-aminoimidazole-5(4)-carboxamide (AImC), 2,2'biimidazole(BiIm) (I. Török et al., J. Inorg. Biochem. 71 (1998) 7-14), and bis (imidazol-2-yl)methane(BiImM) (K. Várnagy et al., J. Chem. Soc., Dalton Trans. (1994) 2939-2945) have been evaluated by using the recently published stability constants and by applying the recently established log K(ML)M versus pK(HL)H straight-line plots (L. E. Kapinos et al., Inorg. Chim. Acta 280 (1998) 50-56) which hold for simple imidazole-type ligands. The indicated analysis regarding the intramolecular equilibrium between a monodentatally imidazole-nitrogen-coordinated (open) species and a chelated isomer provides helpful insights, e.g., the formation degree of chelates is more favored if six-membered rings can be formed, as in the case with M(BiImM)2+ compared to M(BiIm)2+, though in both instances the formation degree of the chelates is large. The formation degree of chelates in the M(ImA)+ complexes increases in the series Zn(ImA)+ (87%)<Ni(ImA)+ (96%)<Cu(ImA)+ (99.5%). A carbonyl oxygen, if sterically favorably positioned as in the M (AImC)2+ complexes, may also participate well in chelate formation. In this way a carbonyl group can certainly be activated via metal ion coordination and become ready for further reactions. For Ni2+, Cu2+, and Zn2+ the formation degree of the chelated M(AImC)2+ isomers varies between about 30 and 75%. In all of the so-called 'open' species the metal ion is solely coordinated to a pyridine-like nitrogen of the imidazole residue. Some further observations of biological interest are indicated.

Cations, Divalent↗
PubMed2000

Detection of genetic variation in Indian population groups using a novel minisatellite probe and finding relationships through tree construction.

Genetic variation in HaeIII-digested genomic DNA samples from different individuals belonging to population groups from Bengal, Uttar Pradesh (UP), Punjab, and South India was assessed at hypervariable loci, using a minisatellite probe, pBA1.2 (accession number, AF 157691), the repeat unit of which was 24 mer long and rich in G-bases. Comparison of DNA profiles between individuals showed a very low probability of band sharing, which ranged from 0.18 to 0.24. A dendrogram, based on Nei's genetic distance, constructed by the neighbor-joining method, showed the formation of separate clusters by both South Indian and non-Indian samples, whereas the construction of a dendrogram based on the Unweighted pair group method arithmetic average (UPGMA) method with Jaccard's similarity coefficient at the individual level led to the formation of several small clusters which were interleaved; also, the subgroups for each of the populations were intermingled with the subgroups for the other populations. A separate analysis was carried out to check the consistency of the proximity between different individuals forming a cluster and between those individuals who were in the vicinity of two clusters. The dendrograms thus obtained did not change the relationship between the individuals from all the populations studied. Despite the distinct clustering observed in the population group comparison, a probable admixture was reflected in the finding that some individuals belonging to one population group were dispersed or embedded within a cluster generated by the individuals of another population group, when a minute dissection of the data for generating a tree at the individual level was carried out.

DNA Fingerprinting↗
PubMed2000

Modulation of CD11C+ splenic dendritic cell functions in murine visceral leishmaniasis: correlation with parasite replication in the spleen.

BALB/c mice resolve Leishmania donovani infection in the liver over an 8-12-week period. However, after an initial phase of 2-4 weeks where increases in parasite load are not readily detectable, parasite numbers in the spleen begin to increase reaching maximum levels at 16 weeks post-infection. Thereafter, parasite replication in the spleen is controlled and BALB/c mice maintain this residual parasite load in the spleen for many months, without further increase. We evaluated functions of CD11C+ splenic dendritic cells throughout the course of L. donovani infection in the spleen of BALB/c mice. Unlike the dendritic cell (DC)-specific antigen DEC-205, CD11C was not up-regulated on macrophages during visceral leishmaniasis. No appreciable impairment of splenic DC functions was observed when this antigen-presenting cell subset was purified from 30-day post-infected mice. Significant impairment in inducing allogeneic mixed lymphocyte reaction (MLR) and presenting L. donovani antigens or keyhole limpet haemocyanin (KLH) to specific T cells was observed with CD11C+ splenic DC purified from 60-day post-infected mice. Functional impairment of splenic DC at 60 days post-infection correlated with their reduced surface expression of major histocompatibility complex (MHC) class II molecules, impairment of interleukin-12 (IL-12) production and to their ability to suppress interferon-gamma (IFN-gamma) production by Leishmania antigen-primed T cells. Of interest, the impairment of splenic DC in presenting Leishmania antigens or KLH to specific T cells was corrected at 120 days post-infection, and correlated with their up-regulation of MHC class II expression, IL-12 production, induction of IFN-gamma by Leishmania antigen-primed T cells and the onset of control over splenic parasite replication in vivo. These results indicate that functional integrity of DC may be important in controlling L. donovani infection.

Animals↗
PubMed2000

Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.

Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator methionine in the pBA0.6 sequence.

Base Sequence↗