Biomedical subjects
Publications and source records attributed to A Ono.
A self-complementary decadeoxyribonucleotide, 5'd(GAAGFGCTTC)3', containing 5-fluorocytosine (F) in substitution for cytosine at the methylation site of DNA-cytosine methylase HhaI (MHhaI) has been synthesized. MHhaI was inhibited by the pre-incubation of the enzyme with d(GAAGFGCTTC).
Early hepatic lesions in rats fed ethionine plus a choline deficient (ECD) diet were examined histopathologically. The purpose of this experiment was to examine preventive and suppressive effects of drugs on fatty or cirrhotic liver induced by ECD, but contrary to our expectations, all groups except the normal diet group showed neoplastic lesions in the liver. Macroscopically, milky-white nodules were seen in most all the rats except for a few dead ones. Microscopically, the characteristic lesions consisted of neoplastic nodules, glandular structures and oval cell hyperplasia. The glandular structures were already present in a rat that died on day 34 of administration and showed neoplastic developmental structures morphologically similar to cholangiofibroma. The neoplastic nodules appeared later than the glandules and were observed in rats that died after day 42. To the best of our knowledge, this is the first report of hepatic lesions consisting of mainly glandular structures induced by an ECD diet.
The first case of primary gastric lymphoma associated with Behçet's disease is reported. A 43-year-old woman, who had been treated for Behçet's disease for 15 years, was diagnosed as low-grade and small lymphocytic malignant lymphoma of the stomach. Although the patient had been treated for Behçet's disease, chemotherapy was performed and a complete remission of gastric lymphoma was achieved. The literature regarding the association of malignant diseases with Behçet's disease is briefly reviewed.
A novel 2'-deoxyuridine analogue carrying an aminobutyl linker at 1'-position of the sugar residue was synthesized and incorporated into oligonucleotides, then an anthraquinone derivative was attached to the amino group. The oligonucleotides carrying the linker groups were more resistant to nuclease P1 and venom phosphodiesterase than an unmodified oligonucleotide.
The ocular manifestations in 65 Japanese human immunodeficiency virus (HIV)-seropositive patients were examined. Based on the cumulative totals, 22 of the cases had acquired immunodeficiency syndrome (AIDS), 17 had AIDS-related complex (ARC), and 35 were asymptomatic carriers (AC), including 4 AIDS cases who had progressed from ARC and 5 ARC cases from AC. Seventy-seven percent of the AIDS cases had ocular manifestations, including cotton-wool spots (50%), retinal hemorrhages (59%), cytomegalovirus retinitis (46%) and pupil abnormalities (14%). The ocular signs were also seen in 71% of the ARC cases and 37% of the AC cases. In Japanese HIV-seropositive patients, ocular manifestations are also as common as in Western HIV-seropositive patients.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
The effects of insulin on peripheral nervous system are unknown. We therefore studied the effects of insulin on sympathetic nerve activity in isolated mesenteric arteries of Sprague-Dawley rats. The overflow of norepinephrine (NE) by electrical stimulation was used as the index of sympathetic nervous system activity. Insulin (0.5 to 1U/l) decreased the NE release in a dose-dependent fashion. This inhibitory effect was, however, reversed by either 5 x 10(-5)M cocaine or 5 x 10(-4)M ouabain treatment. Thus, we postulate that insulin attenuates NE overflow from peripheral sympathetic nerve endings, probably due to enhanced NE reuptake.
Explore the source record for details and available documents.
Oligodeoxyribonucleotides containing N6-methoxyadenine (M) have been synthesized. The order of stability of duplexes consisting of synthesized oligodeoxyribonucleotides, 5'd(CCTGGTAXCAGGTCC)3'-5'd(GGACCTGNTACCAGG)3' (X = M, A, G. N = A, G, T, C), was M: A (Tm = 52 degrees C) greater than M: T (50 degrees C) greater than M: G (48 degrees C) greater than M: C (46 degrees C) observed by thermal denaturation in a buffer of 0.01 M Na cacodylate, and 0.1 M NaCl at pH 7.0. The Tms are within a range of 6 degrees of difference, which is smaller than those of Tms of the duplexes containing A:N pairs (11 degrees) and G:N pairs (11 degrees). DNA replication study on a template-primer system, 5'd(32p-CAGCTTTCGC)3' 3'd(GTCGAAAGCGMAGTCG)5', showed that TTP and dCTP were incorporated into DNA strands at a site opposite to M by Klenow DNA polymerase, but dATP and dGTP were not.
Novel monoclonal antibodies were raised against sarcoplasmic reticulum calcium (Ca2+)-ATPase of human skeletal muscle. Immunohistochemical analysis demonstrated that these antibodies, designated 6F5 and 7F10, bind Ca(2+)-ATPase of non-muscle tissue of the adult including parathyroid, islets of Langerhans, anterior lobe of the pituitary gland and photoreceptor cells of the retina as well as skeletal muscle. A positive reaction was also found for fetal tissues including skeletal muscle, heart, chondrocytes and peripheral nerves. Our results for distribution suggest that Ca(2+)-ATPase is strongly expressed in the tissues and cells in which signal transduction is actively carried out by Ca2+ release from the cytoplasmic Ca2+ pool.
We attempted to determine the plasma endothelin-1-like immunoreactivity (ET-1) levels and to evaluate its physiological significance in 29 neonates: 5 with respiratory distress syndrome (RDS), 3 with transient tachypnoea of the newborn (TTN), 4 with neonatal asphyxia, 5 with bronchopulmonary dysplasia (BPD) following RDS, 7 healthy preterm infants and 5 healthy full-term infants. Plasma ET-1 levels in infants with RDS were significantly higher than those in healthy full-term infants through the 1st week of life. Plasma ET-1 levels in infants with neonatal asphyxia were high on the first 2 days of life and then gradually decreased to those of healthy full-term infants. Plasma levels in infants with TTN were the same as those in healthy full-term infants. Plasma ET-1 levels in infants with BPD were high when compared with those in healthy preterm infants during the first 2 months of life. This study showed that plasma levels were markedly elevated for a long time in the infants with respiratory distress. We speculate that plasma ET-1 may be a specific marker for pulmonary endothelium injury in infants with respiratory distress.
The cytokine tumor necrosis factor-alpha (TNF alpha) is one of the major mediators of septic shock. Because vasodilation is a hallmark of sepsis and decreased vascular responsiveness has been implicated in the pathogenesis of septic shock, we studied the effect of TNF alpha on the mean blood pressure in conscious rats and vascular responsiveness to vasoconstrictors ex vivo using the standard organ bath method. Intravenous infusion of TNF alpha (0.006 or 0.06 mg/kg/hr for 10 hours) decreased mean blood pressure in a dose-dependent fashion. Contractile responses to norepinephrine were depressed dose-dependently in the aortic rings both with and without its endothelium. Aortic contractions by potassium depolarization were also depressed. These results suggest that TNF alpha induces non-specific vascular hyporesponsiveness, which is independent of the presence of the endothelium. The TNF alpha-induced vascular hyporesponsiveness might contribute to the hypotensive action of TNF alpha.
A 54-year-old man was diagnosed with hereditary spherocytosis. An X-ray of the chest disclosed bilateral round masses in the upper and lower posterior mediastinum. CT showed homogeneous round masses of soft tissue density in the posterior mediastinum. A needle biopsy of the mass showed hyperplastic erythroid bone marrow. Fatty metamorphosis of the masses was observed in CT 2 years after splenectomy but showed no change in size.
Explore the source record for details and available documents.
Smoking cessation instruction for individuals using a standardized smoking cessation manual and a handout developed by the authors was studied in a controlled trial among employees who visited a health center for Industrial Safety and Health Law mandated annual health examinations. Smokers in the study group were given 5-10 minutes smoking cessation instruction mainly by public health nurses and nutritionists following the above-mentioned manual and using the handouts. Subjects in both groups were interviewed by telephone to assess changes in smoking habits one month after the first contact. Smoking clients who came on Friday (132) and on Monday (93) were assigned to study and control groups, respectively. One hundred and nineteen members (90.2%) of the study group and 88 (94.6%) of the control group were successfully followed until one month after the initial contact. Seven subjects in the study group were not smoking one month after the instruction, while no one gave up smoking in the control group (p less than 0.05). It was confirmed by telephone survey that 6 of the 7 subjects who were not smoking at one month were still maintaining abstinence from smoking one year after the instruction. Smokers who did not stop smoking reported a reduction in their smoking dose in the study group. Lighter smokers reacted more readily to instruction than did heavier smokers and the knowledge level of subjects was positively associated with the success rate.
The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)
Explore the source record for details and available documents.