Search PubMed⌕ Search

Biomedical subjects

A MacDonald

Publications and source records attributed to A MacDonald.

At least 55 records · Page 3Linked to original sources

An inter-disciplinary approach to swallowing problems in acute stroke.

Many speech and language therapy (SLT) departments are in danger of being swamped with dysphagia referrals, often to the detriment of other work. At the same time surveys have shown that large numbers of patients with acute stroke have swallowing problems which are poorly managed during the critical early phase, not referred or missed altogether. The Collaborative Dysphagia Audit (CODA) study, carried out in six British hospitals, showed that nurses could quickly be trained to carry out basic screening assessments for dysphagia and that implementation of a co-ordinated inter-disciplinary dysphagia management policy (DMP) could substantially improve the proportion of dysphagic patients in whom appropriate feeding precautions were taken. These early DMPs were limited by the need for ward staff to keep all patients with suspected swallowing impairment nil by mouth until assessed by SLT, so in some acute stroke units nurses have been trained to a higher level which allows them to manage most routine transient swallowing problems, leaving only complex or persistent cases for referral to SLT. This approach has been used successfully in our unit in Gateshead, where a dysphagia nurse specialist post has been set up to act as a link between ward staff and SLTs, to ensure that the necessary training levels are maintained and to co-ordinate the DMP.

Acute Disease↗

Functional characterization of alpha1-adrenoceptor subtypes in human subcutaneous resistance arteries.

The functional characteristics of the alpha1-adrenoceptor subtypes in human resistance arteries are still not clear. We recently reported that the alpha1A-adrenoceptor predominantly mediates contraction to norepinephrine in human skeletal muscle resistance arteries. In this study we extended these investigations to human subcutaneous resistance arteries. Arterial segments were isolated from the inguinal subcutaneous fat and mounted on a small vessel wire myograph. Potencies of agonists and antagonists were examined. N-[5-(4,5-dihydro-1H-imidazol-2yl)-2-hydroxy-5,6,7,8-tetrahydronaphthalen-1-yl]methanesulphonamide (A-61603) was found to be 10- and 54-fold more potent than norepinephrine and phenylephrine, respectively. Brimonidine (UK 14304) evoked significantly smaller contractile responses than norepinephrine and phenylephrine, showing the presence of a small population of alpha2-adrenoceptors in these arteries, and this was confirmed by the studies with selective alpha1- and alpha2-adrenoceptor antagonists prazosin and (8aR,12aS,13aS)-5,8,8a,9,10,11,12,12a,13a-decahydro-3-methoxyl-12-(ethylsulphonyl)-6H-isoquino[2,1-g][1,6]-naphthyridine (RS 79948). Prazosin, 5-methyl-urapidil, and 2-[2,6-dimethoxyphenoxyethyl]aminomethyl)-1,4-benzodioxane (WB 4101) shifted the potency of norepinephrine concentration dependently giving pA2 values of 9.4, 8.9, and 10.1, respectively, showing the presence of the alpha1A-subtype in these arteries. Pretreatment with 1 and 10 microM chloroethylclonidine did not affect the potency of and maximum responses to norepinephrine, ruling out the presence of the alpha1B-subtype in these arteries. 8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4.5]decane-7,9-dione (BMY 7378, 10 and 100 nM) did not affect the potency of norepinephrine but a small shift was observed by 1 microM BMY 7378, giving a pK(B) value of 7.1, much less than that reported for the alpha1D-subtype. These results suggest the predominant involvement of alpha1A-adrenoceptor in the contractile responses to norepinephrine in these arteries. The physiological role of this subtype in the maintenance of peripheral arterial resistance is yet to be confirmed.

Adrenergic alpha-Agonists↗

Regulation of sensitivity to 5-hydroxytryptamine in pulmonary supernumerary but not conventional arteries by a 5-HT(1D)-like receptor.

Bovine pulmonary supernumerary arteries are more sensitive to 5-hydroxtryptamine (5-HT) (pD(2) 6.43+/-0.25) than conventional arteries (pD(2) 5.32+/-0.16). This study investigated receptors for 5-HT in ring segments of these arteries. The 5-HT(2) receptor agonist, 2,5 dimethoxy-4-iodoamphetamine hydrobromide (DOI) constricts both arteries. The selective 5-HT(2) receptor antagonist ritanserin produced insurmountable antagonism of 5-HT concentration-response curves in both arteries, whereas the 5-HT(1B/1D) receptor antagonist N-[4-methoxy-3-(4-methyl-1-piperazinyl)phenyl]-2'-methyl-4'(5-methyl- 1,2,4-oxadiazol-3-yl[1,1,-biphenyl]-4-carboxamide hydrochloride (GR127935) produced much greater antagonism in supernumerary arteries. In rings preconstricted with 9,11-dideoxy-9, 11-methanoepoxy prostalagdin F(2alpha) (U46619) and relaxed with the adenylyl cyclase activator forskolin, the selective 5-HT(ID) receptor agonist 2-[5-[3-(4-methylsulphonylamino) benzyl-1,2, 4-oxadiazol-5-yl]-1H-indole-3-yl] ethylamine (L694247) reversed the relaxation. Concentration-response curves for L694247-induced reversal of forskolin-relaxation were antagonised by GR127935 in supernumerary (pK(B) 8.6) and conventional (pK(B) 8.4) arteries, whereas concentration-response curves to 5-HT-were less sensitive to antagonism by GR127935T and this was more obvious in conventional (pK(B) 7.6) than supernumerary (pK(B) 8.1) arteries. Neither the selective 5-HT(1D) receptor antagonist (1-(3-chlorophenyl)-4-[3, 3-diphenyl (2-(S,R) hydroxypropanyl)piperazine] hydrochloride (BRL15572) nor the 5-HT(1B) receptor antagonist (2,3,6, 7-tetrahydro-1'-methyl-5-[2'methyl-4'5-(methyl-1,2,4-oxadiazol-3-y l) biphenyl-4-carbonyl]furo[2,3-f]indole-3-spiro-4'-piperidine hydrochloride (SB224289) antagonised concentration-response curves induced by 5-HT or 5-HT(1)-receptor-selective agonists. In addition to the 5-HT(2A) receptor, 5-HT activates a GR127935-sensitive and a GR127935-insensitive receptor in these arteries. Supernumerary arteries have a greater proportion of GR127935-sensitive receptors, which display only some of the pharmacological characteristics of the cloned 5-HT(ID) receptor. It is possible that the GR127935-sensitive receptor could be a species homologue of the human 5-HT(1B) receptor that is insensitive to SB224289.

15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5↗

Role of endothelium/nitric oxide in atypical beta-adrenoceptor-mediated relaxation in rat isolated aorta.

The role of endothelium in the modulation of classical and atypical beta-adrenoceptor-mediated vasorelaxation was investigated in ring preparations of rat isolated thoracic aorta. Rings were pre-constricted with a sub-maximal concentration of noradrenaline (1 microM) and relaxant responses to cumulative concentrations of beta-adrenoceptor agonists obtained. Endothelium removal or pretreatment with N(G)-nitro-L-arginine methyl ester (L-NAME, 100 microM) or 1H-[1,2,4] oxadiazolol[4,3,-a] quinoxalin-1-one (ODQ, 10 microM) significantly reduced the relaxant effects of isoprenaline, but had less effect on relaxant responses to the atypical beta-adrenoceptor agonist, (+/-)-4-(3-t-butylamino-2-hydroxypropoxy)-benzimidazol-2-one hydrochloride (CGP 12177A). Sodium nitroprusside (3 nM) shifted the isoprenaline concentration-response curve to the left and restored the attenuated responses in the presence of L-NAME back to control levels. Sodium nitroprusside had little effect on the CGP 12177A concentration-response curve. The results show that the endothelium/nitric oxide (NO) pathway modulates beta-adrenoceptor-mediated vasorelaxation in rat aorta and that classical beta-adrenoceptors are modulated to a greater extent than atypical beta-adrenoceptors.

Adrenergic beta-Agonists↗

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗

Role of the 5-HT(2A)receptor and alpha(1)-adrenoceptor in the contractile response of rat pulmonary artery to 5-HT in the presence and absence of nitric oxide.

This study investigated the role of 5-HT(2A)receptors and alpha(1)-adrenoceptors in the contractile response to 5-HT in the first branch pulmonary artery of the rat and their interaction with endogenous nitric oxide. 5-HT and phenylephrine induced concentration-dependent contractions. The alpha(1)-adrenoceptor antagonists prazosin, HV723 and phentolamine produced concentration-dependent rightward shifts of the 5-HT concentration-response curves (CRC) consistent with an action at alpha(1)-adrenoceptors. The 5-HT(2)receptor antagonists ritanserin, ketanserin and methysergide produced rightward shifts that were less than would have been predicted for an action solely at 5-HT(2A)receptors. 5-HT and phenylephrine CRCs were shifted to the left by l -NAME. Endothelium denudation also increased the tissue sensitivity to 5-HT. In the presence of l -NAME, ketanserin produced greater antagonism of the 5-HT CRC but not the phenylephrine CRC. Ketanserin also produced greater antagonism of the 5-HT CRC in endothelium denuded rings compared with endothelium intact rings. These findings indicate (a) that both the alpha(1)-adrenoceptor class and the 5-HT(2A)receptor is involved in the contractile response to 5-HT; (b) in the presence of endogenous nitric oxide the contractile response to 5-HT is mediated predominently by alpha(1)-adrenoceptors; (c) inhibition of endogenous nitric oxide potentiates the 5-HT(2A)receptor-mediated component of the contraction.

Animals↗

Diet and compliance in phenylketonuria.

UNLABELLED: In phenylketonuria, compliance and diet is a difficult issue; it is hard to quantify and is under-researched. It is influenced by many factors. Failure to consume prescribed quantity of protein substitute has been commonly reported and is probably affected by their acceptability, format and timing of administration. There are few reports documenting actual phenylalanine intake and blood phenylalanine control, but it is possible that the more rigorous systems for allocation of phenylalanine are associated with worse compliance. The dry, hard and insipid nature of many low protein products may lead to their under usage and consequent boredom and hunger. The diet becomes increasingly harder to maintain as children grow older and seek fewer constraints in their meals. CONCLUSION: In phenylketonuria, encouraging adherence to diet requires continual education, reinforcement and support from the family and professionals within the support team.

Child↗

Clinical pharmacokinetics and therapeutic drug monitoring of sirolimus.

BACKGROUND: Sirolimus is a novel macrocyclic antibiotic that has an immunosuppressive mechanism of action distinct from that of cyclosporine and tacrolimus. OBJECTIVE: The objective of this report is to provide an overview of the clinical development of sirolimus with emphasis on the mechanism of immunosuppressive activity, prevention of acute renal allograft rejection, clinical pharmacokinetics, concentration-effect relationships, and therapeutic drug monitoring (TDM). RESULTS: Pharmacokinetic studies in adult renal transplant patients have shown that sirolimus may be characterized as a drug with rapid absorption (t(max) = 1 to 2 hours), low systemic availability (F = 14%), linear dose proportionality (2 to 24 mg), extensive partitioning into formed blood elements (B/P = 36), large apparent volume of distribution (1.7 L/kg), prolonged terminal half-life (62 hours), and large intersubject (CV = 52%) and intrasubject (CV = 26%) variability in oral-dose clearance. Results from phase 111 pivotal trials showed that sirolimus (2 or 5 mg/d) reduced acute renal graft rejection (generally, P < 0.01) without TDM. Although TDM may not be required for a regimen consisting of full-dose cyclosporine and corticosteroids with sirolimus 2 mg/d (4 hours after cyclosporine), it may be warranted in patients (1) with hepatic impairment, (2) who are young children, (3) who are receiving concurrent doses of strong CYP3A/p-glycoprotein inhibitors or inducers, (4) in whom cyclosporine dosing is markedly reduced or discontinued, and (5) who are at a high risk for rejection. A whole-blood sirolimus therapeutic window of 5 to 15 ng/mL (measured by microparticle enzyme immunoassay) is recommended for patients at standard risk of rejection. The large intrapatient variability observed in trough sirolimus concentrations indicates that dose adjustments should be optimally based on more than a single trough sample. Because of the time required to reach steady state, sirolimus dose adjustments would optimally be based on trough levels obtained >5 to 7 days after a dose change. CONCLUSIONS: The effective use of sirolimus in an immunosuppressive regimen for the prevention of acute renal allograft rejection requires an understanding of the drug's clinical pharmacokinetics, concentration/adverse-effect relationship, concentration-efficacy relationship, and TDM.

Animals↗

Beta 1-, beta 2- and atypical beta-adrenoceptor-mediated relaxation in rat isolated aorta.

beta-adrenoceptor-mediated relaxation was investigated in ring preparations of rat isolated thoracic aorta. Rings were pre-constricted with a sub-maximal concentration of noradrenaline (1 microM) and relaxant responses to cumulative concentrations of beta-adrenoceptor agonists obtained. The concentration-response curve (CRC) to isoprenaline was shifted to the right by propranolol (0.3 microM) with a steepening of the slope. Estimation of the magnitude of the shift from EC(50) values gave a pA(2) of 7.6. Selective beta(1)- and beta(2)-adrenoceptor antagonists, CGP 20712A (0.1 microM) and ICI 118551 (0.1 microM), respectively, produced 4 and 14 fold shifts of the isoprenaline CRC. Atypical beta-adrenoceptor agonists also produced concentration-dependent relaxation of aortic rings. The order of potency of the beta-adrenoceptor agonists was (-log EC(50)): isoprenaline (6. 25)>cyanopindolol (5.59)>isoprenaline+propranolol (5.11)>CGP 12177A (4.40)>ZD 2079 (4.24)>ZM 215001 (4.07)>BRL 37344 (3.89). Relaxation to CGP 12177A and ZM 215001 was unaffected by propranolol (0.3 microM). SR 59230A (</=1 microM) and cyanopindolol (1 microM), beta(3)-adrenoceptor antagonists, had no effect on the isoprenaline (in the presence of propranolol) or CGP 12177A CRCs. Bupranolol and CGP 20712A, at microM concentrations (beta(4)-adrenceptor antagonists), inhibited responses to isoprenaline (in the presence of propranolol) and CGP 12177A. In conclusion, atypical beta-adrenoceptors co-exist with beta(1)- and beta(2)-adrenoceptors in rat aorta. Although non-conventional partial agonists and selective beta(3)-adrenoceptor agonist cause relaxation, the vascular atypical beta-adrenoceptor does not appear to correspond to the beta(3)-adrenoceptor. There are, however, similarities with the putative beta(4)-adrenoceptor.

Acetylcholine↗

Angiographic embolization for major haemorrhage after upper gastrointestinal surgery

AIMS: Severe postoperative haemorrhage after upper gastrointestinal surgery is a serious complication. This study examined the effectiveness of selective mesenteric angiography (SMA) in localizing a bleeding point and the ability of angiographic haemostatic methods to control bleeding. METHODS: The case notes of a consecutive series of nine patients undergoing urgent SMA during 1996-1998 were analysed. Examination of angiography suite records confirmed the accuracy of patient identification. SMA was performed 18 times with 13 embolizations in nine individuals (seven men; median age 54 (27-73) years). Patients underwent the following operations: Whipple pancreaticoduodenectomy (four patients), pancreatic necrosectomy (two), total gastrectomy (one), cholecystectomy (one) and splenectomy (one). The median interval from surgery to haemorrhage was 15 (2-49) days. Six patients presented with haematemesis/melaena and three with bleeding from drains. Seven had evidence of shock (systolic blood pressure less than 100 mmHg, pulse more than 100 per min); the mean preprocedure haemoglobin concentration was 59 g/l. A median of 8 (4-14) units of blood were transfused before embolization and 4 (2-9) units after. Ten initial endoscopies were performed in six patients, seven of which revealed a source of bleeding. Endoscopic haemostasis was attempted in five and achieved temporary control of bleeding in two. RESULTS: Angiography revealed a discrete bleeding point in 13 of 18 procedures in eight patients. Where a bleeding point was identified, angiographic embolization using 3-8-mm stainless steel coils (ten) or a combination of coils and gelatin sponge (three) achieved radiological evidence of haemostasis in all cases. Periprocedural complications occurred in one patient with unintentional partial embolization of the right hepatic artery during embolization of an actively bleeding left hepatic artery pseudoaneurysm. Rebleeding occurred in six patients within 48 h. Three rebleeds were successfully managed with repeat SMA and embolization (one patient required a third embolization); the remaining three required surgery. Definitive radiological haemostasis was achieved in six patients. Five of the nine patients died in hospital, two of whom had been successfully embolized. CONCLUSIONS: In this group of patients, endoscopy contributed relatively little to treatment of postoperative haemorrhage. In contrast, SMA identified a bleeding point in eight of nine patients and achieved definitive control of bleeding in six. SMA and embolization appears to have a useful role in patients with this infrequent but potentially lethal complication.

Journal Article↗

Dietary practices and use of the ketogenic diet in the UK.

With the introduction of Internet communications, parental interest has increased in the use of the ketogenic diet for epilepsy. It was decided to audit current practice in the use of the ketogenic diet in the UK. All paediatric dietitians who were members of the Paediatric Group of the British Dietetic Association were surveyed by a postal questionnaire. There was a 51% response rate. Twenty-two hospitals (17%) used the ketogenic diet with 101 patients being treated. Fifty-nine percent used the traditional 4:1 (four parts fat : one part carbohydrate, one part protein) classical ketogenic diet and 41% used the medium chain triglyceride diet (60% MCT fat). The age of patients ranged from 1 to over 11 years. There were wide variations in its application, with 66% of hospitals initiating the diet in hospital and 33% at home. The dietary energy administered varied from 60 to 90 kcal/kg/day, and there was no consistent policy on vitamin and mineral supplementation. Twenty-five patients continued to follow the diet after 12 months. Therefore, the ketogenic diet is commonly used for the treatment of intractable epilepsy in the UK. Further research work is needed on its nutritional safety and application.

Child↗

The relationship of genotype to cognitive outcome in galactosaemia.

AIMS: To evaluate the cognitive outcome of a cohort of children with galactosaemia in relation to genotype. METHODS: The cohort was drawn from children notified to the British Paediatric Surveillance Unit galactosaemia study which ran from 1988 to 1990. Cognitive outcome was assessed using the Wechsler Intelligence Scale for Children or the Wechsler Preschool and Primary Scale of Intelligence. Parents completed a questionnaire detailing educational status, and the attending paediatrician returned a questionnaire regarding age at diagnosis and biochemical outcome over the previous two years. RESULTS: A total of 45 children were genotyped: 30 were homoallelic for the Q188R mutation, the remainder being heteroallelic for Q188R with K285N (n = 4), L195P (n = 4), or other mutations (n = 7). Psychometric evaluation was available in 34 cases: mean full scale IQ was 79, verbal quotient 79, and performance quotient 82. Genotype was not related to galactose-1-phosphate (Gal-1-P) concentrations. However, children homoallelic for the Q188R mutation had significantly lower IQ scores than those who were heteroallelic (73. 6 v 94.8). This difference was independent of social and demographic influences and Gal-1-P concentrations over the previous two years. CONCLUSIONS: In children with galactosaemia, cognitive outcome appears to relate to genotype rather than metabolic control, as reflected by Gal-1-P concentrations. The value of measuring Gal-1-P concentrations routinely once successfully established on a galactosaemia diet is questionable as concentrations do not appear to affect outcome. In the UK population, homozygosity for the Q188R mutation is invariably associated with a poor outcome, and there is evidence that variability in neurocognitive outcome is at least part dependent on allelic heterogeneity.

Child↗

Fluid collections detected by ultrasound following uncomplicated colorectal surgery.

The aim of the study was to assess the incidence and site of intraperitoneal fluid collections following uncomplicated colorectal surgery and to identify factors relating to the presence of such collections. 38 patients (22 males) with a mean age of 67 years (range 38-85 years) undergoing uncomplicated colorectal procedures were studied prospectively. Patients underwent abdominal and pelvic ultrasound on Day 3 and Day 7 following surgery. The number, site and volume of collections were recorded. Ultrasound-detected fluid collections were present in 26% on Day 3 and 25% on Day 7 following laparotomy. The presence of a collection was not related to the amount of residual volume after peritoneal lavage with normal saline prior to operative closure, to intraoperative blood loss or to the presence of drains. The right upper quadrant was the commonest site of intraperitoneal collections. In the absence of additional clinical signs, the presence of such collections is not an indication for intervention.

Adult↗

5-hydroxytryptamine- and U46619-mediated vasoconstriction in bovine pulmonary conventional and supernumerary arteries: effect of endogenous nitric oxide.

We compared 5-hydroxytryptamine (5-HT)- and U46619-mediated contractions in bovine pulmonary conventional arteries (CA) and supernumerary arteries (SA). The effects of the NO synthase inhibitor N(G)-nitro-L-arginine methyl ester (L-NAME) (100 microM) and the guanylate cyclase inhibitor 1H-[1,2,4]oxadiazolo[4, 3-a]quinoxalin-1-one (ODQ) (10 microM) on the responses of CA and SA to 5-HT and U46619 were also examined. In addition, the effects of the 5-HT(2B) receptor antagonist SB 200646 (1 nM-1 microM) on the responses to 5-HT in SA and CA were studied. Tissue cGMP levels were measured in the absence and presence of L-NAME, ODQ, 5-HT and U46619. 5-HT was approximately 30 times more potent in SA ¿-log[EC(50) (M)] (pEC(50)) 6.32+/-0.13¿ than in CA (5.05+/-0.14). U46619 displayed a similar potency in both CA (pEC(50) 7.80+/-0.07) and SA (7.75+/-0. 12). L-NAME did not significantly alter the resting tone of CA or SA. In contrast, ODQ produced a transient increase in the tone of both CA and SA. Neither L-NAME nor ODQ altered the responses to 5-HT or U46619 in CA. In addition, neither L-NAME nor ODQ altered the responses to U46619 in SA, but both L-NAME and ODQ increased the magnitude of the response to 5-HT in SA without changing the sensitivity. Inhibition of the 5-HT(2B) receptor with SB 200646 did not alter the response to 5-HT in SA or CA. Basal levels of cGMP (pmol/mg of protein) were similar in CA (1.16+/-0.33) and SA (0. 8+/-0.51), and were not significantly changed in the presence of 5-HT or U46619. L-NAME and ODQ reduced the basal levels of cGMP in both SA and CA. The results suggest that endogenous NO selectively attenuates the vasoconstrictor response to 5-HT in SA, but not in CA. These results also suggest that the NO/cGMP pathway may have a role in maintaining low vascular tone, but that other mechanisms are able to compensate for the absence of this pathway.

15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5↗

A cluster of cases of legionnaires' disease associated with exposure to a spa pool on display.

Interviews with four apparently sporadic cases of legionnaires' disease identified by laboratory reporting in one health district revealed that three of the four cases had been exposed to a new design of spa pool on display at a retail outlet. The fourth case had been exposed to the same design of spa pool in a private home. None had bathed in the spa pool. Legionella pneumophila serogroup 1 mAB subgroup 'Philadelphia' was isolated from samples taken from both spa pools. The display pool had not been maintained as recommended for a public spa pool in use by bathers. Revised maintenance instructions were issued to all purchasers of these spa pools in the United Kingdom (UK) and overseas. Patients may not remember specific exposures; scrutiny of activity diaries helped to identify exposure to a common location. Even when not in use by bathers, spa pools on display can be a source of legionella infection and should be maintained according to current hygiene guidelines.

Biofilms↗

Iron supplemented formula milk related to reduction in psychomotor decline in infants from inner city areas: randomised study.

OBJECTIVE: To compare the effect of unmodified cows' milk and iron supplemented formula milk on psychomotor development in infants from inner city areas when used as the main milk source. DESIGN: Double blind, randomised intervention trial. SETTING: Birmingham health centre. SUBJECTS: 100 infants, mean age 7.8 months (range 5.7 to 8.6 months), whose mothers had already elected to use unmodified cows' milk as their infant's milk source. INTERVENTION: Changing to an iron supplemented formula milk from enrolment to 18 months of age, or continuing with unmodified cows' milk. MAIN OUTCOME MEASURES: Developmental assessments using Griffiths scales at enrolment and at 18 and 24 months. RESULTS: 85 participants completed the trial. There were no significant differences in haemoglobin concentration between the two groups at enrolment, but by 18 months of age 33% of the unmodified cows' milk group, but only 2% of the iron supplemented group, were anaemic (P<0.001). The experimental groups had Griffiths general quotient scores that were not significantly different at enrolment, but the scores in both groups declined during the study. By 24 months the decrease in the mean scores in the unmodified cows' milk group was 14.7 whereas the decrease in the mean scores in the iron supplemented group was 9.3 (P<0.02, 95% confidence interval 0.4 to 10.4). Mean subquotient scores were considerably lower in the unmodified cows' milk group at 24 months; significantly so for personal and social scores (P<0.02, 1.2 to 16.8 [corrected]). CONCLUSION: Replacing unmodified cows' milk with an iron supplemented formula milk up to 18 months of age in infants from inner city areas prevents iron deficiency anaemia and reduces the decline in psychomotor development seen in such infants from the second half of the first year.

Anemia, Iron-Deficiency↗