Search PubMed⌕ Search

Biomedical subjects

A M Krieg

Publications and source records attributed to A M Krieg.

At least 37 records · Page 2Linked to original sources
PubMed2001

Type I interferon is the primary regulator of inducible Ly-6C expression on T cells.

Ly-6C has been proposed as a marker of memory CD8+ T cells. Reports have indicated that Ly-6C is upregulated after T cell receptor (TCR) stimulation or exposure to proinflammatory cytokines. This study examined the relative roles of proinflammatory cytokines and TCR engagement in Ly-6C induction. In vitro experiments tested the effects of cytokines on Ly-6C expression and confirmed interferon-alpha (IFN-alpha) as a primary cytokine that induces Ly-6C expression on CD4+ and CD8+ T cells. The amount and duration of Ly-6C expression were examined on T cells after in vivo induction of proinflammatory cytokines (CpG oligodeoxynucleotides [ODN]) or TCR activation (staphylococcal enterotoxin B [SEB]). In vivo, proinflammatory cytokines transiently upregulated Ly-6C on T cells in the absence of TCR stimulation. TCR stimulation by SEB transiently upregulated Ly-6C expression on antigen-specific and antigen-nonspecific T cells but did not cause long-term upregulation of Ly-6C expression in either population. IFN-alpha was confirmed as a primary inducer of Ly-6C in vivo, as CpG ODN were unable to induce Ly-6C expression in IFN-alphaRI(-/-) mice. Thus, inducible Ly-6C expression on CD4+ and CD8+ T cells is largely due to IFN-alpha in the environment and appears not to be directly correlated with the development of T cell memory.

Animals↗
PubMed2001

From bugs to drugs: therapeutic immunomodulation with oligodeoxynucleotides containing CpG sequences from bacterial DNA.

Several types of immune cells possess pattern recognition receptors (PRR) that can distinguish prokaryotic DNA from vertebrate DNA by detecting unmethylated CpG dinucleotides in particular base contexts (CpG motifs). Bacterial DNA or synthetic oligodeoxynucleotides containing these CpG motifs activate both innate and acquired immune responses that have evolved to protect against intracellular infections. These T helper 1 (Th1)-like immune responses include activation of B cells, dendritic cells, macrophages, and natural killer (NK) cells. CpG DNA-induced immune activation can protect against infection either alone or in combination with a vaccine and is effective in the immunotherapy of allergic diseases and cancer. Human clinical trials using such CpG DNA are currently underway.

Adjuvants, Immunologic↗
PubMed2001

CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-kappaB activation.

Bacterial DNA and CpG-oligodeoxyribonucleotides (ODN) are powerful B cell activators, inducing apoptosis protection, cell cycle entry, proliferation, costimulatory molecule expression, immunoglobulin (Ig) and interleukin-6 (IL-6) secretion. However, proximal events in B cell activation by ODN are only partially characterized, including the translocation of NF-kappaB to the nucleus. In this paper, we provide evidence that CpG-ODN-induced cell cycle entry and apoptosis protection are blocked by SN50 or gliotoxin and thus require NF-kappaB activation. NF-kappaB activation occurred within 30 minutes of stimulation of murine B cells with a phosphorothioate (S) CpG-ODN and persisted for up to 40 hours, with p50, p65, and c-Rel as the major components. Similar to other NF-kappaB inducers, CpG-ODN caused an early IkappaBalpha and IkappaBbeta degradation plus cleavage of the p50 precursor and subsequent NF-kappaB nuclear translocation. A group of closely related S-ODN, which specifically blocked CpG-induced B cell activation at submicromolar concentrations, also prevented NF-kappaB DNA binding and transcriptional activation. These inhibitory S-ODN differed from stimulatory S-ODN by having 2-3 G substitutions in the central motif. As inhibitory S-ODN did not directly interfere with the NF-kappaB DNA binding but prevented CpG-induced NF-kappaB nuclear translocation of p50, p65, and c-Rel and blocked p105, IkappaBalpha, and IkappaBbeta degradation, we concluded that their putative target must lie upstream of inhibitory kinase (IKK) activation.

Active Transport, Cell Nucleus↗
PubMed2001

CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved.

Oligodinucleotides containing CpG motifs stimulate vertebrate immune cells in vitro, have proven efficacy in murine disease models and are currently being tested in human clinical trials as therapies for cancer, allergy, and infectious disease. As there are no known immunostimulatory motifs for veterinary species, the potential of CpG DNA as a veterinary pharmaceutical has not been investigated. Here, optimal CpG motifs for seven veterinary and three laboratory species are described. The preferential recognition of a GTCGTT motif was strongly conserved across two vertebrate phyla, although a GACGTT motif was optimal for inbred strains of mice and rabbits. In a subsequent adjuvanticity trial, the in vitro screening methodology was validated in sheep, representing the first demonstration of CpG DNA efficacy in a veterinary species. These results should provide candidate immunostimulant and therapeutic drugs for veterinary use and enable the testing of CpG DNA in large animal models of human disease.

Animals↗
PubMed2001

Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-alpha production through activation of NF-kappaB.

Unmethylated CpG motifs in bacterial DNA (CpG DNA) activate host innate immune responses synergistically with some other microbial products, such as endotoxins, and may contribute to disease pathogenesis through excessive production of proinflammatory cytokines. Because monocyte-derived tumor necrosis factor (TNF)-alpha is an important mediator of disease, we investigated whether CpG DNA and lipopolysaccharide (LPS) synergize for inducing TNF-alpha biosynthesis. CpG DNA and LPS synergistically induce TNF-alpha production in RAW264.7 cells and J774 cells through activation of NF-kappaB. Furthermore, transient transfection with a super-repressive mutant of IkappaBalpha (IkappaBalpha-AA) demonstrated that NF-kappaB plays a critical role in CpG DNA-mediated TNF-alpha expression. Like NF-kappaB activation, CpG DNA-induced activation of mitogen-activated protein kinases (MAPK) regulates TNF-alpha production. Both extracellular receptor kinase (ERK) and p38 can regulate TNF-alpha gene transcription induced by CpG DNA. Although CpG DNA at the higher concentration slightly enhanced LPS-mediated phosphorylation of ERK, it did not alter the LPS-mediated activation of c-Jun N-terminal kinase and p38. In addition, CpG DNA showed little or no enhancement of LPS-mediated AP-1 activation. These results suggest that CpG DNA- and LPS-mediated signals converge at or above the level of NF-kappaB and ERK, and that there are distinct, as well as common, signaling pathways which are utilized by both CpG DNA and LPS for activating various transcription factors and MAPK.

Animals↗
PubMed2001

CpG DNA induces cyclooxygenase-2 expression and prostaglandin production.

Unmethylated CpG motifs found in bacterial DNA are potent activators of the innate and acquired immune systems, and rapidly induce the production of proinflammatory cytokines. We hypothesized that CpG DNA may also elicit the production of prostaglandins (PG), which are central lipid mediators of the immune and inflammatory response. To test our hypothesis, we stimulated murine spleen cells and RAW 264.7 murine macrophage cells with CpG DNA and assessed the effects on the PG synthesis pathway. Compared to control, DNA-containing CpG motifs induced >5-fold increase in PGE (2) production and rapidly up-regulated cyclooxygenase-2 (COX-2) at both the mRNA and protein level. CpG DNA was an extremely strong inducer of COX-2 as concentrations as low as 3 ng/ml induced COX-2 protein expression. The CpG DNA-induced PGE (2) down-regulated the immune response elicited by CpG. Blockade of PGE (2) production with selective COX-2 inhibitors or neutralizing anti-PGE (2) antibody markedly enhanced IFN-gamma secretion in vitro from CpG DNA-stimulated spleen cells. Moreover, selective COX-2 inhibition increased CpG DNA-induced IFN-gamma secretion in vivo. Inhibition of COX-2 also increased CpG DNA-induced lytic activity of NK cells. Taken together, these data indicate that DNA containing CpG motifs is a potent inducer of COX-2 and PGE (2) production. CpG-induced PG may subsequently down-regulate the immune and inflammatory responses elicited by the CpG DNA.

Adjuvants, Immunologic↗
PubMed2001

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Adjuvants, Immunologic↗
PubMed2001

CpG DNA increases primary malignant B cell expression of costimulatory molecules and target antigens.

Multiple factors, including expression of costimulatory molecules, antigen-presenting molecules, and target antigens, likely impact the efficacy of antibody therapy and other approaches to the immunotherapy of B cell malignancy. Unmethylated CpG-dinucleotides in select base contexts ("CpG motifs") that resemble sequences found in bacterial DNA are potent immunostimulatory agents capable of inducing a complex immune response, including a strong B cell stimulus. We examined the effect of a potent human CpG oligonucleotide (CpG ODN 2006) on different types of primary human malignant B cells and reactive follicular hyperplasia. CpG oligodeoxynucleotide (CpG ODN), but not control (non-CpG ODN), increased the expression of costimulatory molecules (CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells obtained from reactive follicular hyperplasia. CpG ODN also enhanced expression of class I and class II MHC in most samples. CD20 expression was increased in response to CpG ODN, most notably in B-CLL and marginal zone lymphoma. An inverse correlation was found between baseline expression of CD20 and CD40 and their expression after exposure to CpG ODN, thus the most significant increase in expression of these molecules was found in those samples that had the lowest baseline levels. In conclusion, CpG ODN can lead to increasing expression of molecules involved in costimulation, antigen presentation, and as targets for antibody-based therapy and deserve further evaluation as potential immunotherapeutic agents for B cell malignancy.

Antigen Presentation↗
PubMed2001

Enhancing vaccines with immune stimulatory CpG DNA.

Certain vertebrate immune cells have evolved receptors that detect the presence of pathogen DNA based on its content of unmethylated CpG dinucleotides in particular base contexts. This 'CpG DNA' acts as a 'danger signal', triggering protective innate and acquired immune responses. The activity of CpG DNA can be mimicked with synthetic oligodeoxynucleotides, which when added to a vaccine greatly boost the resulting immune response.

Adjuvants, Immunologic↗
PubMed2000

CpG DNA induces maturation of dendritic cells with distinct effects on nascent and recycling MHC-II antigen-processing mechanisms.

Murine bone marrow cultured with GM-CSF produced dendritic cells (DCs) expressing MHC class II (MHC-II) but little CD40, CD80, or CD86. Oligodeoxynucleotides (ODN) containing CpG motifs enhanced DC maturation, increased MHC-II expression, and induced high levels of CD40, CD80, and CD86. When added with Ag to DCs for 24 h, CpG ODN enhanced Ag processing, and the half-life of peptide:MHC-II complexes was increased. However, Ag processing was only transiently enhanced, and exposure of DCs to CpG ODN for 48 h blocked processing of hen egg lysozyme (HEL) to HEL(48-61):I-A(k) complexes. Processing of this epitope required newly synthesized MHC-II and was blocked by brefeldin A (BFA), suggesting that reduced MHC-II synthesis could explain decreased processing. Real-time quantitative PCR confirmed that CpG ODN decreased I-A(beta)(k) mRNA in DCs. In contrast, RNase(42-56):I-A(k) complexes were generated via a different processing mechanism that involved recycling MHC-II and was partially resistant to BFA. Processing of RNase(42-56):I-A(k) persisted, although at reduced levels, after CpG-induced maturation of DCs, and this residual processing by mature DCs was completely resistant to BFA. Changes in endocytosis, which was transiently enhanced and subsequently suppressed by CpG ODN, may affect Ag processing by both nascent and recycling MHC-II mechanisms. In summary, CpG ODN induce DC maturation, transiently increase Ag processing, and increase the half-life of peptide-MHC-II complexes to sustain subsequent presentation. Processing mechanisms that require nascent MHC-II are subsequently lost, but those that use recycling MHC-II persist even in fully mature DCs.

Adjuvants, Immunologic↗
PubMed2000

APC stimulated by CpG oligodeoxynucleotide enhance activation of MHC class I-restricted T cells.

Oligonucleotides containing unmethylated CpG motifs (cytosine-phosphorothioate-guanine oligodeoxynucleotide (CpG ODN)) are potent immunostimulatory agents capable of enhancing the Ag-specific Th1 response when used as immune adjuvants. We evaluated the cellular mechanisms responsible for this effect. Development of a CTL response was enhanced when mice were immunized with peptide-pulsed dendritic cells (DCs) treated with CpG ODN. However, in vitro, CpG ODN had no direct effect on highly purified T cells. In vitro, CpG ODN treatment of peptide- or protein-pulsed DCs enhanced the ability of the DCs to activate class I-restricted T cells. The presence of helper T cells enhanced this effect, indicating that treatment with CpG ODN does not obviate the role of T cell help. The enhanced ability of CpG ODN-treated DCs to activate T cells was present but blunted when DCs derived from IL-12 knockout mice were used. Fixation of Ag-pulsed, CpG ODN-treated DCs limited their ability to activate T cells. In contrast, fixation had little effect on DC activation of T cells when DCs were not exposed to CpG ODN. This indicates that production of soluble factors by DCs stimulated with CpG ODN plays a particularly important role in their ability to activate class I-restricted T cells. We conclude that CpG ODN enhances the development of a cellular immune response by stimulating APCs such as DCs, to produce IL-12 and other soluble factors.

Adjuvants, Immunologic↗
PubMed2000

Enhanced dendritic cell maturation by TNF-alpha or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo.

Dendritic cells (DC) manipulated ex vivo can induce tumor immunity in experimental murine tumor models. To improve DC-based tumor vaccination, we studied whether DC maturation affects the T cell-activating potential in vitro and the induction of tumor immunity in vivo. Maturation of murine bone marrow-derived DC was induced by GM-CSF plus IL-4 alone or by further addition of TNF-alpha or a cytidine-phosphate-guanosine (CpG)-containing oligonucleotide (ODN-1826), which mimics the immunostimulatory effect of bacterial DNA. Flow cytometric analysis of costimulatory molecules and MHC class II showed that DC maturation was stimulated most by ODN-1826, whereas TNF-alpha had an intermediate effect. The extent of maturation correlated with the secretion of IL-12 and the induction of alloreactive T cell proliferation. In BALB/c mice, s.c. injection of colon carcinoma cells resulted in rapidly growing tumors. In this model, CpG-ODN-stimulated DC cocultured with irradiated tumor cells also induced prophylactic protection most effectively and were therapeutically effective when administered 3 days after tumor challenge. Thus, CpG-ODN-enhanced DC maturation may represent an efficient means to improve clinical tumor vaccination.

Adjuvants, Immunologic↗
PubMed2000

CpG DNA is an effective oral adjuvant to protein antigens in mice.

We have previously reported that synthetic oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG ODN) are potent adjuvants to protein administered by intramuscular (IM) injection or intranasal (IN) inhalation to BALB/c mice. Herein, we have evaluated oral delivery of CpG ODN with purified hepatitis B surface antigen (HBsAg) or tetanus toxoid (TT) to determine its potential as an adjuvant to oral vaccines. CpG ODN augmented systemic (IgG in plasma, CTL, T-cell proliferation) and mucosal (IgA in lung, vaginal or gut washes, feces and saliva) immune responses against both antigens. CpG stimulated both T-helper type 1 (Th1) (CTL, IgG2a) and Th2 (IgG1, IgA) responses when delivered orally. Results from this study indicate that stimulatory CpG ODN may be effective as an adjuvant with oral vaccines.

Adjuvants, Immunologic↗
PubMed2000

Immune effects and mechanisms of action of CpG motifs.

Bacterial DNA differs from vertebrate DNA in having a much higher content of unmethylated CpG dinucleotides, in particular, base contexts that are termed 'CpG motifs'. The vertebrate immune system appears to have evolved pattern recognition molecules that recognize 'CpG motifs' as foreign, and trigger protective immune responses which are strongly Th1-biased. These responses can be mimicked using synthetic oligodeoxyribonucleotides, which have demonstrated remarkable utility as vaccine adjuvants and as immunotherapeutics for treatment of cancer and allergic diseases.

Adjuvants, Immunologic↗
PubMed2000

CpG DNA overcomes hyporesponsiveness to hepatitis B vaccine in orangutans.

Oligonucleotides containing immunostimulatory CpG motifs (CpG ODN) have been shown to be potent Th1-type adjuvants for augmenting antigen-specific responses in mice against hepatitis B surface antigen (HBsAg). The hepatitis B virus (HBV) infects only humans and great apes and appears to exist among wild chimpanzees and orangutans. An outbreak of HBV among orangutans being rehabilitated for re-introduction to the jungle caused the death of several animals. A prophylactic vaccination program revealed that orangutans are quite hypo-responsive to a current commercial vaccine compared to results obtained previously in humans and chimpanzees. Addition of CpG ODN to hepatitis B vaccine greatly increased the seroconversion rate and the titers of antibody against HBsAg (anti-HBs). This is the first demonstration of CpG DNA in a great ape and the results have important implications for the vaccination of humans against HBV and other diseases.

Adjuvants, Immunologic↗
PubMed2000

Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides within specific sequence contexts (CpG motifs) are detected, like bacterial or viral DNA, as a danger signal by the vertebrate immune system. CpG ODN synthesized with a nuclease-resistant phosphorothioate backbone have been shown to be potent Th1-directed adjuvants in mice, but these motifs have been relatively inactive on primate leukocytes in vitro. Moreover, in vitro assays that predict in vivo adjuvant activity for primates have not been reported. In the present study we tested a panel of CpG ODN for their in vitro and in vivo immune effects in mice and identified in vitro activation of B and NK cells as excellent predictors of in vivo adjuvant activity. Therefore, we tested >250 phosphorothioate ODN for their capacity to stimulate proliferation and CD86 expression of human B cells and to induce lytic activity and CD69 expression of human NK cells. These studies revealed that the sequence, number, and spacing of individual CpG motifs contribute to the immunostimulatory activity of a CpG phosphorothioate ODN. An ODN with a TpC dinucleotide at the 5' end followed by three 6 mer CpG motifs (5'-GTCGTT-3') separated by TpT dinucleotides consistently showed the highest activity for human, chimpanzee, and rhesus monkey leukocytes. Chimpanzees or monkeys vaccinated once against hepatitis B with this CpG ODN adjuvant developed 15 times higher anti-hepatitis B Ab titers than those receiving vaccine alone. In conclusion, we report an optimal human CpG motif for phosphorothioate ODN that is a candidate human vaccine adjuvant.

Adjuvants, Immunologic↗
PubMed2000

Mechanism and function of a newly identified CpG DNA motif in human primary B cells.

The vertebrate immune system recognizes bacterial DNA based on the presence of unmethylated CpG-dinucleotides in particular base contexts ("CpG motifs"). In contrast to mice, knowledge about CpG-mediated effects on human B cells is poor. In the present study we identify and determine an optimal human CpG motif. A phosphodiester oligonucleotide containing this motif strongly stimulated CD86, CD40, CD54, and MHC class II expression, IL-6 synthesis, and proliferation of primary human B cells. These effects required internalization of the oligonucleotide and endosomal maturation. The molecular mechanism of action of this CpG motif was associated with the sustained induction of the NF-kappaB p50/p65 heterodimer and of the transcription-factor complex AP-1. Transcription-factor activation by CpG DNA was preceded by increased phosphorylation of the stress kinases c-Jun N-terminal kinase and p38, and of activating transcription factor-2. In contrast to CpG, signaling through the B cell receptor led to activation of extracellular receptor kinase and to phosphorylation of a different isoform of c-Jun N-terminal kinase. These studies define the structure of a highly active human CpG motif and characterize its molecular mechanism of action in primary human B cells.

Activating Transcription Factor 2↗