Search PubMed⌕ Search

Biomedical subjects

A Lindberg

Publications and source records attributed to A Lindberg.

At least 73 records · Page 4Linked to original sources
PubMed1998

Domiciliary liquid oxygen versus concentrator treatment in chronic hypoxaemia: a cost-utility analysis.

Whether long-term oxygen therapy (LTOT) improves quality of life in chronic hypoxaemia has been questioned. LTOT with an oxygen concentrator (C/C) and gas cylinders for ambulation is considered cumbersome compared to mobile liquid oxygen equipment (L). The hypothesis for this study was that LTOT with liquid oxygen treatment (L) improves patients' health-related quality of life, but that it is also more expensive compared to concentrator (C/C) treatment. A prospective, randomized multicentre trial comparing C/C with L for LTOT was conducted during a six-month period. Fifty-one patients (29 on L and 22 on C/C) with chronic hypoxaemia, regularly active outside the home, participated in the study initially. Costs for oxygen were obtained from the pharmacies. Patient diaries and telephone contacts with members of the healthcare sector were used to estimate costs. Health-related quality of life was measured by the Sickness Impact Profile (SIP) and the EuroQol, instruments at the start and after 6 months. The average total cost per patient for group C/C for the six-month period was US$1,310, and for group L it was US$4,950. Health-related quality of life measured by the SIP instrument showed significant differences in favour of group L in the categories/dimensions of physical function, body care, ambulation, social interaction and total SIP score. In conclusion, liquid-oxygen treatment was more expensive compared to concentrator treatment. However, treatment effects showed that liquid oxygen had a better impact on quality of life.

Chronic Disease↗
PubMed1998

A mutation in the lipoprotein lipase gene associated with hyperlipoproteinemia type I in mink: studies on lipid and lipase levels in heterozygotes.

Severe hypertriglyceridemia was previously observed in mink. Affected animals had no detectable lipoprotein lipase activity, but normal amounts of lipoprotein lipase protein in post-heparin plasma. We have now cloned cDNA for lipoprotein lipase from normal mink and identified a single point mutation in the affected animals which most likely explains the deficiency of active lipase. The mutation is located in exon 6 and results in a Pro214Leu substitution. In heterozygote mink the levels of lipoprotein lipase activity and mass in post-heparin plasma were lower than in normal mink, but could not be used to identify carriers of the mutation. In some tissues (heart, muscle, kidney and lung), lipoprotein lipase activity was decreased to about 50%. In adipose tissue there seemed to be a mechanism to compensate for the mutation, resulting in increased mass and approximately the same activity of lipoprotein lipase as in animals not carrying the mutation. Mink had high lipoprotein lipase activity and mass in kidneys, although the levels of mRNA in kidney were many fold lower than in adipose tissue. Mink had very low levels of cholesteryl ester transfer protein activity in plasma. This may contribute to the high levels of HDL in this animal species.

Adipose Tissue↗
PubMed1997

Factors determining pubertal growth and final height in growth hormone treatment of idiopathic growth hormone deficiency. Analysis of 195 Patients of the Kabi Pharmacia International Growth Study.

A total of 195 children (117 males and 78 females) with idiopathic growth hormone deficiency (IGHD) treated with growth hormone (GH) for at least 1 year before puberty onset and who had completed treatment to adult height, were selected from the KIGS database for study of growth during puberty. Spontaneous and induced puberty started at 13.8 and 14.9 years in boys and at 12.9 and 13.7 years in girls, respectively. Duration of GH treatment and height gained prepubertally were greater when puberty was induced; prepubertal catch up growth (expressed as a percentage of the difference between target height and height at start of GH) was greater when puberty was induced in boys (59% induced vs. 45% spontaneous, p < 0.001), and in girls (72% induced vs. 53.9% spontaneous, p < 0.01). Final height was attained at 17.8 and 19.2 years in boys and at 16.0 and 17.0 years in girls following spontaneous and induced puberty, respectively. Final heights were greater after induced puberty compared with spontaneous puberty in boys (171.3 vs. 166.0 cm, p < 0.001) and in girls (157.0 vs. 155.0 cm, n.s.). Target height was also significantly greater in boys with spontaneous puberty (172.2 cm vs. induced = 174.2 cm) as compared to girls (spontaneous = 158 cm vs. induced = 160 cm). Duration of pubertal growth was longer in boys compared to girls (3.6 vs. 3.0 years, p < 0.001) and was negatively correlated with age, height, and distance from target height at onset of puberty, but was not correlated with the dose of GH. Catch-up growth during puberty (expressed as a percentage of the difference between target height and height at puberty onset) after induced and spontaneous puberty was 87.9% and 80.5% (not significant) in boys and 66.4% and 75.5% (not significant in girls. Total pubertal growth (TPG) (cm) was inversely correlated with prepubertal growth by simple linear regression. Multiple linear regression analysis indicated 5 independent predictors of TPG accounting for 78% of the variability, namely sex (boys grew more), distance of target height from height at onset of puberty (+), dose of GH at onset of puberty (+), age at onset of puberty (-), and age at end of growth (+).

Adolescent↗
PubMed1996

Apolipoprotein CII from chicken (Gallus domesticus). The amino-terminal domain is different from corresponding domains in mammals.

The amino acid sequence of chicken apolipoprotein CII (apoCII) was determined from cDNA sequencing and from partial protein sequencing. The chicken sequence showed an overall identity of around 30% to all the other previously known apoCII sequences. Comparison of the carboxyl-terminal domain (residues 51-79, human numbering) showed at least 50% identity between species. By limiting the region to residues 51-70 the similarity was remarkably high, about 85%. This is in concert with the previous opinion that residues in the region 56-76 are directly engaged in binding to lipoprotein lipase and in activation of this enzyme. In contrast, in the amino-terminal end up to residue 50 (human numbering) less than 24% of the amino acid residues in chicken apoCII were identical to residues of any of the other species. In addition, chicken apoCII is four residues longer than human apoCII (83 versus 79 residues), probably due to an extension at the amino-terminal end. Although the sequence was completely different in the amino-terminal domain, the structures necessary for binding to lipid appear to be present in chicken apoCII. Secondary structure prediction showed that the amino-terminal domain could form two amphipathic alpha-helices in almost similar areas of the sequence as was previously predicted for human apoCII.

Amino Acid Sequence↗
PubMed1996

Growth hormone treatment of short children born small for gestational age or with Silver-Russell syndrome: results from KIGS (Kabi International Growth Study), including the first report on final height.

The response to growth hormone (GH) therapy was studied in children born small for gestational age (SGA; n = 593) and in those with Silver-Russell syndrome (SRS; n = 127) using data from KIGS (Kabi International Growth Study). For the SGA patients, median birth weight was -2.6 SD scores (SDS), treatment was started at a median age of 9.2 years, at a time when median height was -2.8 SDS while median target height was -1.4 SDS. For the SRS patients, median birth weight was -3.1 SDS, treatment was started at a median age of 7.0 years, at a time when median height was -3.4 SDS with a median target height of -0.1 SDS. GH treatment increased height SDS in both SGA children and patients with SRS; in 16 SGA patients treated to (near) final height with GH (median dose, 0.7 IU/kg/week), height minus target height SDS was -2.0 at the start of treatment and -1.0 at final height. In conclusion, the results obtained in KIGS indicate that GH treatment of short children born SGA is effective in increasing final height above the predicted height and in achieving the target height.

Abnormalities, Multiple↗
PubMed1995

An epidemiologic study of Lyme disease in southern Sweden.

BACKGROUND: Lyme disease is the most common vector-borne infection in some temperate regions of the Northern Hemisphere. However, for most areas of endemic disease reliable epidemiologic data are sparse. METHODS: Over a one-year period, we conducted a prospective, population-based survey of cases of Lyme disease in southern Sweden. The diagnosis was made on the basis of the presence of erythema migrans at least 5 cm in diameter or characteristic clinical manifestations such as arthritis, neuroborreliosis, and carditis. RESULTS: We identified 1471 patients with Lyme disease, for an overall annual incidence of 69 cases per 100,000 inhabitants. The incidence varied markedly according to geographic region, and there were several areas where disease was widely prevalent. The incidence varied according to age, with the highest rates among people 5 to 9 and 60 to 74 years of age, but not according to sex. The most frequent clinical manifestation was erythema migrans (seen in 77 percent of all cases), followed by neuroborreliosis (16 percent) and arthritis (7 percent). Carditis was rare. A preceding tick bite was reported by 79 percent of the patients. Bites in the head and neck region were more common among children than among adults and were associated with an increased risk of neuroborreliosis. CONCLUSIONS: Lyme disease is very common in southern Sweden, with a relatively high frequency of neurologic complications and arthritis. With the exception of the low incidence of carditis, the pattern of disease we found in Sweden was similar to that reported in the United States.

Adolescent↗
PubMed1995

Lipase evolution: trout, Xenopus and chicken have lipoprotein lipase and apolipoprotein C-II-like activity but lack hepatic lipase-like activity.

Lipoprotein lipase and hepatic lipase are members of a gene family which also contains pancreatic lipase. High activity of lipoprotein lipase is present in extrahepatic tissues in all mammals studied and also in birds. The activity of hepatic lipase varies more. To investigate the evolutionary relationship, lipase activities in tissues of some lower vertebrates were measured. In fish and in frog, low activities with the characteristics of lipoprotein lipase were found. Serum from frog and from fish, and plasma from chicken, stimulated lipoprotein lipase in vitro, indicating that these species contain analogues to human apolipoprotein C-II. Little or no hepatic lipase-like activity was found in post-heparin plasma or in liver homogenates of chickens. In fish liver, lipase activity with an apparent heparin affinity similar to, or even higher than lipoprotein lipase was found. Frog liver contained a small amount of lipase activity with high heparin affinity. This activity was inhibited both by apolipoprotein C-II and by 1 M NaCl. It is not clear whether the low lipase activities in livers from fish and from frog are variants of hepatic lipase. Since lipoprotein lipase and apolipoprotein C-II are already present in fish, this lipase probably evolved before hepatic lipase.

Animals↗
PubMed1995

Structural features in lipoprotein lipase necessary for the mediation of lipoprotein uptake into cells.

Lipoprotein lipase (LpL) has been shown to mediate the uptake of lipoproteins into cells. The uptake is initiated by binding of LpL to cell surface proteoglycans and to the low density lipoprotein (LDL) receptor-related protein. This ability of LpL is independent of catalytic activity and depends on the intact dimeric structure of the lipase and functional residues in the C-terminal domain. The goal of this study was to identify structural features in LpL that are essential in the mediation of lipoprotein uptake. Naturally occurring variants and LpL mutants produced by site-directed mutagenesis were cloned and expressed in COS-cells. A combination of immunoassays and separation on heparin-Sepharose columns was used to determine the molar ratio of monomeric to dimeric LpL in the expression media. The mutants were tested for their ability to mediate the uptake of 125I-labeled beta-VLDL in cultured Hep3b cells in direct comparison with wild type LpL. We found that the concentration of monomer in the media correlated negatively with the effect on the uptake mediated by the dimeric form of LpL. A mutation affecting the catalytic activity (Asp 156Gly) resulted in no significant reduction in the lipase-mediated beta-VLDL uptake. Point mutations in the proposed lipid binding region Trp390Ala or Trp393Ala and the substitution of 390-393 with the homologous hepatic lipase (HL) sequence were also normal, while the deletion of 390-393 reduced the ability to mediate the uptake by about 60% in comparison to wild type. A mutation known to impair heparin binding (Arg294Ala) was also less efficient than the wild type in mediating uptake. In conclusion, it is important to determine the monomer/dimer ratio in mutant preparations as the presence of monomers inhibits the uptake mediated by the dimeric LpL. Moreover, sites involved in heparin and lipid binding between residues 390-421 are important for LpL-mediated lipoprotein uptake.

Catalysis↗
PubMed1994

Perfusible and non-perfusible supports with monoclonal antibodies for bioaffinity chromatography of Escherichia coli penicillin amidase within its pH stability range.

Several monoclonal antibodies (mABs) have been prepared and immobilized for the biospecific isolation of penicillin amidase (PA) from Escherichia coli (EC 3.5.1.11), an enzyme without S-S bridges and a pH stability range of 4-9. During the immobilization the fluorescence emission maxima of the mABs were found to change from 336 nm to ca. 350 nm. Only one of these mABs was found to be suitable for preparative bioaffinity chromatography of PA within the pH stability range. This mAB was immobilized on different spherical supports (Eupergit C 250 L and Sepharose) and one perfusible support (Knauer Quick Disc) and used for analytical and preparative bioaffinity chromatography. Under isocratic conditions the plate height for the perfusible biospecific adsorbent was found to be an order of magnitude lower than for the other supports. The different forms of this proteolytically processed bacterial enzyme could not be separated, however, by the biospecific adsorbents. At the mAB density used in the adsorbents (10-30 microM), less than 30% of the theoretical binding capacity of the immobilized mABs could be used to adsorb the enzyme.

Animals↗
PubMed1994

Growth hormone treatment of idiopathic short stature: analysis of the database from KIGS, the Kabi Pharmacia International Growth Study.

Within the Kabi Pharmacia International Growth Study (KIGS) database, there is information on 1017 (700 male/317 female) patients with idiopathic short stature (ISS). These patients were started on recombinant human growth hormone (GH) at a median age of 10.8 years, a bone age of -1.8 SDS, a height of -2.6 SDS and a predicted adult height (PAH) (Bailey-Pinneau method) of -2.5 SDS. The median dose of GH was 0.6 IU/kg body weight/week and the frequency of injections was six/week. According to the relationship with target height the patients were classified into 'familial short stature (FSS)' (height SDS > target height SDS -1.28) and into 'non-FSS' (height SDS < target height SDS -1.28). During the first year of GH treatment there was an overall increment in the median height velocity from 4.4 to 7.4 cm/year. Over 3 years of GH treatment, cross-sectional analysis demonstrated an overall increment in median PAH of 1.2 SDS. There was a positive correlation between gain in PAH and the GH dose (n = 202, r = 0.18, p < 0.01) during the first year. Longitudinal analysis in 84 patients showed an overall increment of PAH of 0.7 SDS over 2 years of treatment. When applying the KIGS first-year prediction model for patients with idiopathic GH deficiency on cohorts of prepubertal children with FSS and non-FSS, a lower responsiveness to GH in the non-FSS group was observed. It is concluded that higher than substitutive doses of GH are required for the long-term improvement of growth in ISS.

Adolescent↗
PubMed1994

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Adenoids↗
PubMed1993

Detection of enterobacterial lipopolysaccharides and experimental endotoxemia by means of an immunolimulus assay using both serotype-specific and cross-reactive antibodies.

The immunolimulus (IML) assay system uses solid-phase endotoxin antibodies to capture lipopolysaccharide (LPS), which is then quantified by a modification of the chromogenic limulus amebocyte lysate (CLAL) method. Monoclonal antibodies (MAbs) reactive with selected O antigen serotypes of Escherichia coli (O18) and Salmonella typhimurium (O9, 12), when used in the IML, were shown to be highly specific in detecting their respective endotoxins in purified form and in plasma samples from experimentally infected animals. A murine MAb that was broadly cross-reactive with E. coli, Salmonella, and Shigella endotoxins also proved to be highly effective in the IML assay for capturing LPS molecules from both E. coli and S. typhimurium strains. These results indicate that IML assays can detect smooth-type enterobacterial endotoxins in plasma and suggest that such assays have potential for use in the rapid diagnosis of sepsis and endotoxemia caused by different enterobacterial species.

Animals↗