Search PubMed⌕ Search

Biomedical subjects

A L Andreu

Publications and source records attributed to A L Andreu.

At least 19 recordsLinked to original sources
PubMed2007

Molecular genetics of McArdle's disease.

This review highlights recent advances in our understanding of McArdle's disease, including the mechanisms involved in the regulation of the clinical phenotype. The latest molecular genetic studies have demonstrated the genetic heterogeneity of the disorder, with more than 65 mutations identified to date. There is not a specific treatment for McArdle's disease, but some nutritional treatments in combination with aerobic conditioning could improve the quality of life in most patients.

Glycogen Phosphorylase, Muscle Form↗
PubMed2006

Can patients with McArdle's disease run?

Patients with McArdle's disease commonly adopt a sedentary lifestyle. This sedentary behaviour, however, usually worsens the limited exercise capacity of these patients. Although eccentric muscle work can be associated with rhabdomyolysis, supervised eccentric training with gradually increasing loads has important advantages compared with conventional concentric work, particularly for patients with a poor cardiorespiratory system. We report the beneficial effects (particularly, increased VO(2peak) (from 14.6 to 30.8 ml/kg/min) and increased gross muscle efficiency (from 13.8% to 17.2%)) induced by a supervised aerobic training programme of 7 months duration including 3-4 running sessions (< or =60 min/session) per week in a 38-year-old patient. These preliminary data suggest the potential therapeutic value of this type of exercise in these patients.

Adult↗
PubMed2006

Infusion of platelets transiently reduces nucleoside overload in MNGIE.

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by thymidine phosphorylase (TP) deficiency, which leads to toxic accumulations of thymidine (dThd) and deoxyuridine (dUrd). In this work, we report that infusion of platelets from healthy donors to patients with MNGIE restored transiently circulating TP and reduced plasma dThd and dUrd levels, suggesting that treatments to achieve permanent restoration of circulating TP such as allogeneic stem cell transplantation or gene transfer might be therapeutic.

Adolescent↗
PubMed2006

Mobilisation of mesenchymal cells into blood in response to skeletal muscle injury.

Mesenchymal cells recruited to damaged tissues must circulate through the bloodstream. The absolute numbers of circulating mesenchymal stem cells (cMSCs) in two different models of acute and chronic skeletal muscle injury were determined. cMSCs were present in significantly higher numbers in both models than in healthy controls. These results support the hypothesis that MSCs are mobilised into the bloodstream after skeletal muscle tissue damage. These two models (acute and chronic) would be of value in the search for molecular mediators of mobilisation of MSCs into the circulation.

Adult↗
PubMed2006

Exercise capacity in a 78 year old patient with McArdle's disease: it is never too late to start exercising.

The case is reported of a 78 year old man with McArdle's disease and a history of treated coronary heart disease. Despite the pre-exercise administration of sucrose allowing the patient to exercise with normal physiological responses, and without typical McArdle's symptoms or biochemical evidence of muscle damage, his exercise capacity was very low (V(O2)peak = 10.7 ml/min/kg), probably attributable to his lifetime of sedentary living. The data suggest that, with pre-exercise sucrose administration, such patients may be candidates for systematic reconditioning, which may improve functional capacity and quality of life.

Aged↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2005

Variable presentation of the clinical phenotype of McArdle's disease in a kindred harbouring a novel compound genotype in the muscle glycogen phosphorylase gene.

We report a Spanish family with muscle glycogen phosphorylase (PYGM) deficiency (McArdle's disease) harbouring a novel compound genotype (A659D/L586P). Four individuals who had the same genotype for PYGM, showed a wide variability in the presentation of the clinical phenotype, including one patient with a restrictive respiratory pattern, which is unusual in McArdle's disease. Moreover, these patients were studied for the insertion/deletion (I/D) trait in the angiotensin converting enzyme (ACE) which has been suggested to be a strong modulator of severity in McArdle's disease. Our results indicate no association of the I/D ACE trait in this family, suggesting that other factors would be more relevant in determining the severity of the clinical presentation.

Aged↗
PubMed2005

[Description of a new procedure for fiberoptic bronchoscopy during noninvasive ventilation through a nasal mask in patients with acute respiratory failure].

A new method is described for performing oral fiberoptic bronchoscopy during noninvasive ventilation through the nose. The technique was successfully applied in 2 patients suffering from acute respiratory failure. The bronchoscope was inserted through a glove finger fitted into a mouth guard. The system works as a valve and does not affect performance of the bronchoscopy procedure or the pressures administered during noninvasive ventilation. We conclude that the procedure has potential advantages over bronchoscopy through the nose and face masks or helmets, particularly for the management of secretions or in special clinical circumstances (hemoptysis or presence of foreign bodies). This method can be used to substitute for or complement other bronchoscopy techniques performed with other interfaces.

Acute Disease↗
PubMed2004

Molecular analysis of myophosphorylase deficiency in Dutch patients with McArdle's disease.

We report on 8 Dutch patients with McArdle's disease from 6 unrelated families. Molecular analysis revealed the presence of four previously described mutations: the common R49X mutation, the IVS14+1G>A mutation and the recently reported R269X and Y84X nonsense mutations; and two new molecular defects: a missense mutation R138W in the homozygous state in two siblings, and a frameshift mutation c.1797delT. This first genetic study of patients from The Netherlands with McArdle's disease confirms that the R49X mutation is also the most common in Dutch patients, and that there is genetic heterogeneity within this population. Moreover, our data support the hypothesis that the Y84X mutation is a relatively frequent mutation in McArdle's patients with a Central European background, and expand the already crowded map of mutations within the PYGM gene responsible for McArdle's disease.

Base Sequence↗
PubMed2003

Splicing mosaic of the myophosphorylase gene due to a silent mutation in McArdle disease.

The authors report the molecular findings in a patient with McArdle disease who harbored a silent polymorphism (K608K) in the myophosphorylase gene. cDNA studies demonstrated that this polymorphism leads to a severe mosaic alteration in mRNA splicing, including exon skipping, activation of cryptic splice-sites, and exon-intron reorganizations. These findings suggest that, in patients with McArdle disease in whom no pathogenic mutation has been found, any a priori silent polymorphism should be re-evaluated as a putative splicing mutation.

Alternative Splicing↗
PubMed2003

A novel autosomal dominant limb-girdle muscular dystrophy (LGMD 1F) maps to 7q32.1-32.2.

In 2001, the authors described the clinical features of a genetically distinct autosomal dominant limb-girdle muscular dystrophy (LGMD; LGMD 1F). Using a genome-wide screen with more than 400 microsatellite markers, the authors identified a novel LGMD disease locus at chromosome 7q32.1-32.2. Within this chromosomal region, filamin C, a gene encoding actin binding protein highly expressed in muscle, was an obvious candidate gene; however, the authors did not detect any defects in filamin C or its protein product.

Aged↗
PubMed2003

Reversion of mtDNA depletion in a patient with TK2 deficiency.

Mutations in the thymidine kinase 2 (TK2) gene cause a myopathic form of the mitochondrial DNA depletion syndrome (MDS). Here, the authors report the unusual clinical, biochemical, and molecular findings in a 14-year-old patient in whom pathogenic mutations were identified in the TK2 gene. This report extends the phenotypic expression of primary TK2 deficiency and suggests that factors other than TK2 may modify expression of the clinical phenotype in patients with MDS syndrome.

Adolescent↗