Biomedical subjects

A K Shchyolkina

Publications and source records attributed to A K Shchyolkina.

At least 19 recordsLinked to original sources

PubMed2005

Parallel DNA double helices incorporating isoG or m5isoC bases studied by FTIR, CD and molecular modeling.

FTIR spectroscopy has been used to follow the formation of parallel stranded DNA duplexes incorporating isoG or m5isoC bases and determine their base pairing scheme. The results are discussed in comparison with data concerning anti-parallel duplexes with comparable base composition and sequence. In duplexes containing A-T and isoG-C or m5isoC-G base pairs shifts of the thymine C2=O2 and C4=O4 carbonyl stretching vibrations (to lower and higher wavenumbers, respectively, when compared to their positions in classical cis Watson-Crick (WC) base pairs) reflect the formation of trans Watson-Crick A-T base pairs. All carbonyl groups of cytosines, m5isocytosines, guanines and isoguanines are found to be involved in hydrogen bonds, indicative of the formation of isoG-C and m5isoC-G base pairs with three hydrogen bonds. Molecular modeling shows that both structures form regular right handed helices with C2'endo sugar puckers. The role of the water content on the helical conformation of the parallel duplexes has been studied by FTIR and CD. It is found that a conformational transition similar to the B --> A transition observed for anti-parallel duplexes induced by a decrease of the water content of the samples can occur for these parallel duplexes. Their helical flexibility has been evidenced by FTIR studies on hydrated films by the emergence of absorption bands characteristic of A type geometry, in particular by an S-type --> N-type repuckering of the deoxyribose. All sugars in the parallel duplex with alternating d(isoG-A)/d(C-T) sequence can adopt an N-type geometry in low water content conditions. The conformational transition of the parallel hairpin duplex with alternating d(isoG-A)/d(C-T) sequence was followed by circular dichroism in water/trifluoroethanol solutions and its free energy at 0 degrees C was estimated to be 6.6 +/- 0.3 kcal mol(-1).

Base Composition↗

PubMed2001

Protein-free parallel triple-stranded DNA complex formation.

A 14 nt DNA sequence 5'-AGAATGTGGCAAAG-3' from the zinc finger repeat of the human KRAB zinc finger protein gene ZNF91 bearing the intercalator 2-methoxy,6-chloro,9-amino acridine (Acr) attached to the sugar-phosphate backbone in various positions has been shown to form a specific triple helix (triplex) with a 16 bp hairpin (intramolecular) or a two-stranded (intermolecular) duplex having the identical sequence in the same (parallel) orientation. Intramolecular targets with the identical sequence in the antiparallel orientation and a non-specific target sequence were tested as controls. Apparent binding constants for formation of the triplex were determined by quantitating electrophoretic band shifts. Binding of the single-stranded oligonucleotide probe sequence to the target led to an increase in the fluorescence anisotropy of acridine. The parallel orientation of the two identical sequence segments was confirmed by measurement of fluorescence resonance energy transfer between the acridine on the 5'-end of the probe strand as donor and BODIPY-Texas Red on the 3'-amino group of either strand of the target duplex as acceptor. There was full protection from OsO(4)-bipyridine modification of thymines in the probe strand of the triplex, in accordance with the presumed triplex formation, which excluded displacement of the homologous duplex strand by the probe-intercalator conjugate. The implications of these results for the existence of protein-independent parallel triplexes are discussed.

2,2'-Dipyridyl↗

PubMed2001

The telomeric dG(GT)4G sequence can adopt a parallel-stranded double helical conformation.

Oligonucleotides 3'-d(GTGTGTGTGG)-L-d(GGTGTGTGTG)-3' (hp-GT) and 3'-d(G4STG4TG4STG4STGG)-L-d(GGTGTGTGTG)-3' (hp-SGT), (L=(CH2CH2O)3), were shown by use of several optical techniques to form a novel parallel-stranded (ps) intramolecular double helix with purine-purine and pyrimidine-pyrimidine base pairing. The rotational relaxation time of hp-GT was similar to that of a 10-bp reference duplex, and the fraction of unpaired bases was determined to be approximately 7%, testifying to the formation of an intramolecular double helical hairpin by the sequence under the given experimental conditions. A quasi-two-state mode of ps-double helix formation was validated, yielding a helix-coil transition enthalpy of -135 +/- 5 kJ/mol. The G x G and T x T (or 4ST x T) base pair configurations and conformational parameters of the double helix were derived with molecular modeling by force field techniques. Repetitive d(GT) sequences are abundant in telomers of different genomes and in the regulatory regions of genes. Thus, the observed conformational potential of the repetitive d(GT) sequence may be of importance in the regulation of cell processes.

Base Pairing↗

PubMed2000

Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability.

Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT/GC contacts by isolating G.C base pairs exerts a destabilizing effect on the ps duplex. Molecular modeling of the various helices by force field techniques provides insight into the structural basis for these distinctions.

Base Composition↗

PubMed2000

Structural polymorphism of oligo(dC) with mixed alpha,beta-anomeric backbone.

Oligonucleotides with mixed alpha,beta-anomeric backbone have been proposed recently for the recognition of random DNA sequence via new triplex motif (Doronina and Behr, Chem. Soc. Reviews 26, 63-71 (1997)). In the present work we examined alpha- and beta- anomers of cytidine as possible candidates to recognize AT and TA base pairs of the double stranded DNA. The binding properties of beta-oligo(dC) were studied on a series of synthetic oligodeoxynucleotides by UV absorbtion spectroscopy, measurements of bound EtBr fluorescence polarization, circular dichroism (CD) and non-denaturing gel electrophoresis. The UV thermal denaturation, polarization studies and CD experiments with three stranded oligonucleotide 5'-((dCalpha) (dCbeta))5-L-(dAT)5-L-(dAT)5 (L = triethyleneglycol linker) and other oligonucleotide models showed that the formation of semiprotonated oligocytidilic complexes takes place at low temperatures and neutral pH, rather than folding of the clip into intramolecular triplex. The low-temperature transition was observed in denaturation profiles of any oligonucleotide containing beta- or mixed alpha,beta- cytidine stretches at the concentration of 1 microM. Self-association of alpha,beta-oligo(dC) was additionally confirmed by the appearance of two CD bands (at 290 and 265 nm) characteristic of CC+ base pairs. Despite the effective ability of alpha,beta-oligo(dC) to form self-associates, we succeeded in targeting 30-bp AT containing random DNA duplex by a 30-nt alpha,beta-oligocytidilate as evidenced by non-denaturing gel electrophoresis. A complete binding of the duplex was observed at a 5-fold excess of the third strand at 15 degrees C. Along with the formation of the three-stranded complex, self-association of mixed backbone oligo(dC) strands occurred.

Circular Dichroism↗

PubMed1998

FTIR and UV spectroscopy of parallel-stranded DNAs with mixed AT/GC sequences and their AT/IC analogues.

The infrared spectra of parallel-stranded (ps) hairpin duplexes with mixed A*T/G*C composition and either isolated or sequential G*C pairs were studied in comparison with antiparallel-stranded (aps) duplexes and a corresponding set of molecules with hypoxanthine as a G base analogue lacking the exocyclic amino group. The ps duplexes showed the characteristic bands for the C2=O2 and C4=O4 stretching vibrations of thymine residues in trans-Watson-Crick A*T pairing at 1683 and 1668 cm-1. The latter band was superimposed on the stretching vibration of the free C6=O6 group of guanine. Substitution of guanine by hypoxanthine inhibited the formation of ps hairpin duplexes whatever the sequence, demonstrating that in the H-bonding between G and C the 2-NH2 group is necessary for stabilizing all of the investigated ps duplexes. This result is in agreement with a model of trans-Watson-Crick G*C base pairs with two H-bonds [N2H2(G)-N3(C) and N1H(G)-O2(C)]. However, trans-Watson-Crick A*T and G*C base pairs with two H-bonds are not isomorphous, which may explain the decreased stability of the ps, but not the aps, duplexes upon increasing the number of A*T/G*C steps. Molecular modeling studies performed on two of the ps duplexes reveal the existence of propeller twist for avoiding a clash between the N2(G) and N4(C) amino groups, and favorable stacking of sequential G*C base pairs. The optimized hairpin ps duplexes invariably incorporated G*C base pairs with two H-bonds, regardless of the initial structures adopted for the force field calculations.

Adenine↗

PubMed1998

Distamycin-stabilized antiparallel-parallel combination (APC) DNA.

The formation of Antiparallel-Parallel-Combination (APC) DNA, a liner duplex with a segment of parallel-stranded (ps) helix flanked by conventional B-DNA, was tested with a number of synthetic oligonucleotides. The groove-binding ligand distamycin A (DstA) was used to stabilize the ps segment comprising five A x T base pairs. Two drug molecules bound per APC, one in each of the two equivalent grooves characteristic of ps-DNA. APC-DNA, reference molecules and their complexes with DstA were analysed by several methods: circular dichroism and absorption spectroscopy, thermal denaturation, chemical modification, and molecular modeling. The dye binding stoichiometry differed significantly due to inherent structural differences in the groove geometries of ps-DNA (trans base pairs, similar grooves) and conventional antiparallel-stranded (aps) B-DNA (cis base pairs, distinct major and minor grooves). The data support the existence of APC folding in solution.

Circular Dichroism↗

PubMed1997

Stabilizing and destabilizing effects of intercalators on DNA triplexes.

Oligonucleotide-directed triplex formation attracts much attention due to its potential usefulness in diagnostic and biotechnological applications. Among other aspects, the research embraces numerous studies probing the influence of intercalating ligands on triplex stability. The effect of the intercalator on triplex formation and stability is known to depend on nucleotide sequence, type of intercalator and solution conditions. The present work is aimed at determining the average number of intercalated ethidium bromide (EtBr) and acridine orange (AO) molecules leading to the most effective stabilization of triplexes. First, fluorescing complexes of intramolecular parallel (recombinant) triplex 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' (parARB) and classical antiparallel 5'-(dA)10-L-(dT)10-L-(dT)10-3'(antiATT) (L = -pO(CH2CH2O)3p-) with EtBr and AO were characterized, binding constants were obtained and compared to those for homologous DNA duplexes. Then the total EtBr and AO concentrations corresponding to an average of one, two or three intercalated molecules per oligonucleotide were estimated. Thermal denaturation of parARB and antiATT complexes with an average of one, two or three bound molecules was carried out, thermodynamic parameters of the triplex-to-duplex and duplex-to-open-strand transitions were evaluated using a three-state model. The ability of EtBr and AO to stabilize or destabilize both parallel (recombinant) and classical antiparallel triplexes was found to depend strongly on the concentration of bound intercalator. The triplexes were shown to be stabilized by intercalation of the first and second EtBr or AO molecules, while binding of the third intercalator molecule to 10 nucleotide long triplex resulted in significant triplex destabilization.

Acridine Orange↗

PubMed1996

Parallel and antiparallel A*A-T intramolecular triple helices.

Intramolecular triple helices have been obtained by folding back twice oligonucleotides formed by decamers bound by non-nucleotide linkers: dA10-linker-dA10-linker-dT10 and dA10-linker-dT10-linker-dA10. We have thus prepared two triple helices with forced third strand orientation, respectively antiparallel (apA*A-T) and parallel (pA*A-T) with respect to the adenosine strand of the Watson-Crick duplex. The existence of the triple helices has been shown by FTIR, UV and fluorescence spectroscopies. Similar melting temperatures have been obtained in very different oligomer concentration conditions (micromolar solutions for thermal denaturation classically followed by UV spectroscopy, milimolar solutions in the case of melting monitored by FTIR spectroscopy) showing that the triple helices are intramolecular. The stability of the parallel triplex is found to be slightly lower than that of the antiparallel (deltaT(m) = 6 degrees C). The sugar conformations determined by FTIR are different for both triplexes. Only South-type sugars are found in the antiparallel triplex whereas both South- and North-type sugars are detected in the parallel triplex. In this case, thymidine sugars have a South-type geometry, and the adenosine strand of the Watson-Crick duplex has North-type sugars. For the antiparallel triplex the experimental results and molecular modeling data are consistent with a reverse-Hoogsteen like third-strand base pairing and South-type sugar conformation. An energetically optimized model of the parallel A*A-T triple helix with a non-uniform distribution of sugar conformations is discussed.

Carbohydrate Conformation↗

PubMed1995

Parallel purine-pyrimidine-purine triplex: experimental evidence for existence.

Oligonucleotides 5'-d(CT)5-L-d(AG)5-L-d(GA)5-3' and 5'-d(GA)5-L-d(TC)5-L-d(GA)5-3' [L = pO(CH2CH2O)3p] were studied by thermal denaturation, chemical modification and binding of fluorescent dyes. Both oligonucleotides are shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex ether with antiparallel-oriented oligopurine strands (the first compound) or parallel-oriented oligopurine strands (the second compounds). The parallel triplex is significantly less stable than the antiparallel one. On the basis of conformational modeling, possible types of base tripling in the triplets are proposed. Thus our data provide the first convincingly evidence for the existence of a purine-pyrimidine-purine triplex with parallel orientation of identical strands.

Base Sequence↗

PubMed1995

Stabilization of parallel (recombinant) triplex with propidium iodide.

Earlier we have shown that the oligonucleotide 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' [L = pO(CH2CH2O)3p] is able to fold back forming intramolecular RecA-independent triplex with identical strands oriented parallel to each other (parallel triplex) [A.K. Shchyolkina, E.N. Timofeev, O.F. Borisova, I.A. Il'icheva, E.E. Minyat, E.V. Khomyakova, V.L. Florentiev, FEBS Letters 339, 113-118 (1994) (1)]. In this study the propidium iodide (PI) was found to intercalate into the parallel triplex and increase its stability significantly (Tm increased from 21.4 up to 44.4 degrees C in 0.01 M Na phosphate buffer, pH 7, 0.1 M NaCl, when three PI molecules per triplex were bound). Fluorescence excitation and emission spectra, the quantum yield of fluorescence (q = 0.16) and the fluorescence lifetime of PI (tau = 24.5 ns at 3 degrees C) for the parallel triplex studied were shown to be similar to those for DNA. Scatchard binding plots indicated an anticooperative mode of PI binding to the parallel triplex. The association constant is close to that of PI binding to DNA. The fluorescence experiments revealed the maximum number of binding sites to be five PI molecules per one triplex molecule. Molecular mechanics calculation of possible structures for the parallel triplex-PI complex were performed.

Animals↗

PubMed1995

A triple helix obtained by specific recognition of all 4 bases in duplex DNA can adopt a collapsed or an extended form.

It has been proposed that during homologous recombination promoted by RecA DNA triple helices can be formed between a Watson Crick duplex and a homologous third strand without any sequence constraint. A triple helix, obtained by targeting the d(AGTTAGCATG) sequence containing all 4 bases, in which both homologous strands are oriented in a parallel direction with respect to each other, stabilized by addition of Mn2+ ions has been studied by UV and FTIR spectroscopies. We have characterized the sugar conformations of this triplex. All strands are found to contain S type sugars (C2'endo, B family form). Progressive addition of propidium iodide induces a complete reorientation of the sugar geometry to a N type conformation (C3'endo, A family form). This sugar repuckering is consistent with a conformational transition from a collapsed to an extended DNA triple helical structure.

Base Sequence↗

PubMed1994

The R-form of DNA does exist.

Oligonucleotide 5'-d(CATGCTAACT)-L-d(AGTTAGCATG)-L-d(CATGCTAACT)-3' [L = pO(CH2CH2O)3p] is shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex (Tm is about 30 degrees C) with parallel-orientated identical strands (the recombinant or R-form of DNA). Experimental evidence was obtained by studying thermal denaturation, chemical modification and binding of fluorescent probes. The stability of the R-triplex increases in the presence of divalent ions or spermidine. Its structure is characterized by a certain heterogeneity that causes the cooperativity of a triplex-to-duplex transition to decrease. On the basis of conformational modeling, the possible types of base tripling in all four triplets are proposed. The experimental data as well as the molecular mechanic calculations indicate that the stabilities of triplets in the R-triplex decrease in the order: G:C-G = A:T-A >> T:A-T > C:G-C.

Base Sequence↗

PubMed1994

Parallel-stranded DNA with mixed sequence. Evidence for conformational transition in solution at low water activity.

Parallel-stranded deoxyoligonucleotide 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' (I-II) was shown to be stable in solution at 3 degrees-5 degrees C, 0.1-0.25 M NaCl, 10(-2) M phosphate buffer, pH 7.0 by means of a set of fluorescent techniques as well as of conventional optical methods. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity, r.h.). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2' endo sugar conformation to an A-like form designated as Ap. The free energy difference between the Ap and B-like conformation for the parallel duplex is 7.35 kcal/mol which is close to the value 7.40 kcal/mol for the antiparallel 5'd(CTATAGGGAT)3'/3'd(GATATCCCTA)5' (I-III). The ability of parallel helix to transit into Ap form is important for DNA-RNA parallel double helix formation.

Base Composition↗

PubMed1994

Three-stranded clip of the oligonucleotide 5'-(dT)10pO(CH2CH2O)3p(dT)10pO(CH2CH2O)3p(dA)10-3'.

Temperature dependence of UV and CD spectra of the oligonucleotide 5'-(dT)10-L-(dT)10-L-(dA)10-3' [tripl(ATT)] [L = -pO(CH2CH2O)3p-] in phosphate buffer, pH 7, at various NaCl concentrations and in the presence or absence of 0.01 M MgCl2 has been studied. At low oligonucleotide concentrations (2.2 x 10(-5) M nucleotide concentration) all structural transitions proceed intramolecularly. Tripl(ATT) exists in three forms: as a three-stranded clip (at low temperatures), a double-stranded hairpin (at intermediate temperatures), and as an open strand (at high temperatures). Thermodynamic parameters of the triplex formation depending on the NaCl concentration were calculated. The CD spectra were assigned to the single-, double-, and three-stranded forms. Ethidium bromide (EtBr) binding to the three-stranded clip was studied. Ethidium bromide molecules were shown to intercalate into the triple helix with the stable complex formation (association constant is 10(6)). One molecule of three-stranded clip binds not more than three EtBr molecules. The proposed synthetic model (oligonucleotide blocks coupled by hydroxyalkyl chains) has been shown to be convenient for studies of the physical and chemical properties of the triplex and other multistranded complexes of DNA.

Base Composition↗

PubMed1993

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.

Animals↗

PubMed1992

Evidence for the tetraplex structure of the d(GT)n repetitive sequences in solution.

The ability of oligonucleotides 3'-d(GT)5pO(CH2)6Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[par[d(GT)]) to form tertiary structures has been studied. Circular dichroism (CD) as well as the fluorescence of the ethidium bromide (EtBr) complexes with oligonucleotides and hydrodynamic volume measurements in solutions containing 0.01 M phosphate buffer, pH 7 and NaCl in concentrations from 0.1 M to 1 M, have been used. The data obtained in the temperature interval from 3 degrees C to 10 degrees C are in good agreement with the structure suggested earlier where the par[d(GT)] and anti[d(GT)] form structures with four parallel strands in which layers of four G-residues alternate with unpaired bulged-out T-residues. Ethidium bromide interacts with the structure in a cooperative manner. Two ethidium bromide molecules intercalate between two layers of four G-residues.

Base Sequence↗

PubMed1992

Southern molecular hybridization experiments with parallel complementary DNA probes.

We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.

Animals↗