[Stability of AT- and GC-pairs in parallel DNA, corresponding to a native sequence].
Explore the source record for details and available documents.
Biomedical subjects
Publications and source records attributed to A K Shchelkina.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
We showed earlier that oligonucleotides 3'-d(GT)5-pO(CH2CH2O)3p-d(GT)5-3' form bimolecular quadruplexes with parallel orientation of their strands, which are held by guanine quartets alternating with unpaired thymines (GT quadruplex). This work deals with the conformational polymorphism and extensibility of G quadruplexes in complex with molecules of an intercalating agent ethidium bromide (EtBr). A cooperative mechanism of EtBr binding to the GT quadruplex was revealed. The binding constant K = (3.3 +/- 0.1) x 10(4) M-1, cooperativity coefficient omega = 2.5 +/- 0.2, and maximal amount of EtBr molecules intercalated in GT quadruplex (N = 8) were determined. It was proved experimentally by analysis of adsorption isotherms and theoretically by mathematical modeling that the GT quadruplex is capable of double extension, which is indicative of the high elasticity of this four-stranded helix. Two most stable conformations of GT quadruplexes with thymine residues intercalated and/or turned outside were found by mechanico-mathematical modeling. The equilibrium is shifted toward the conformation with the looped out thymine residues upon intercalation of EtBr molecules into the GT quadruplex.
The amino-reactive derivative of tetraphenylporphine meso-tetrakis[4-(carboxy)phenyl]porphine (TCPP) was synthesized, which is characterized by a high molar absorption coefficient (epsilon 416 = 36,500 M-1.cm-1). TCPP was covalently attached to oligonucleotides d(CG)5 [d(CG)5-TCPP] and d(TA)5 [d(TA)5-TCPP]. The spectral characteristics of these complexes were studied in 0.01 M phosphate buffer, pH 7 at 23 degrees C. UV-visible absorption spectra of these complexes have a clearly pronounced Soret band at (414 +/- 1) nm for d(CG)5-TCPP and at (412 +/- 1) nm for d(TA)5-TCPP. The fluorescence spectra of these complexes have maxima at (648 +/- 2) nm for d(CG)5-TCPP and at (658 +/- 2) nm for d(TA)5-TCPP. In this study we also determined fluorescence quantum yields q and fluorescence lifetimes tau [q = 0.099 +/- 0.011, tau = (9.0 +/- 0.3) ns for d(CG)5-TCPP and q = 0.080 +/- 0.011, tau = (8.7 +/- 0.3) ns for d(TA)5-TCPP]. A temperature rise from 5 to 50 degrees C produced only slight (within 23%) emission changes in both samples studied. Taking into account: a) high fluorescence yields (q), b) weak dependence of q on temperature, c) weak q dependence of q on the oligonucleotide type, we conclude that TCPP may be used as a sensitive fluorescence label in DNA studies.
Noncanonical parallel-stranded DNA double helices (ps-DNA) comprising natural nucleotide sequences are usually second in stability to antiparallel-stranded (aps) canonical DNA structures, which ensures reliable cell functioning. However, recent data indicate a possible role of ps-DNA in DNA loops or in trinucleotide repeats connected with neurodegenerative diseases. The review surveys recent studies on the effect of nucleotide sequence on preference of one or other type of DNA duplex. (1) Ps-DNA with mixed AT/GC composition was found to have conformational and thermodynamic properties drastically different from those of Watson-Crick double helix. Its stability depends strongly on the specific sequence in a manner peculiar to the ps double helix, because of the energy disadvantage of the AT/GC contacts. The AT/GC boundary facilitated flipping of A and T out of the ps double helix. Proton acceptor groups of bases are exposed into the both grooves of the ps-DNA and are accessible to solvent and ligands, including proteins. (2) DNA regions containing natural minor bases isoguanine and isomethylcytosine were shown to form ps-DNA with transAT-, trans isoGC, and trans iso5meCG pairs exceeding in stability a related aps duplex. (3) Nucleotide sequence dG(GT)4G from yeast telomeres and microsatellites was demonstrated to form novel ps-DNA with GG and TT base pairing. Unlike d(GT)n and d(GnTm) sequences able to form quadruplexes, the dG(GT)4G sequence formed no alternative double- or multistranded structures in a wide range of experimental conditions, thus suggesting that the nucleotide context governs the observed structural polymorphism of the d(GT)n sequence. The possible biological role of ps-DNA and the prospects of its study are discussed.
The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.
The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.
Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.
The complexation of the new protein vector PGEk--a carrier of nucleic acids into proliferating cells with phosphodiester d(TTAGGG)4 (TMO) and phosphorothioate Sd(TTAGGG)4 (TMS) telomerase inhibitor oligonucleotides was studied. PGEk molecule, consisting of 64 amino acids, is comprising the sequence of the human epidermal growth factor EGFh which is hydrophobic cell targeting moiety serving for receptor-mediated endocytosis and an NLS (nuclear localization signal) which is hydrophilic serving as a DNA-binding and selective nuclear import moiety. Experiments were carried out in 0.01 M Na-phosphate buffer contained 0.1 M NaCl, pH 7.8 at 37 degrees C. CD spectral analysis revealed that TMO molecules folded back into intramolecular antiparallel G-quadruplex while TMS molecules were represented as unstructured thread. The number of adsorbed PGEk molecules were estimated using PGEk intrinsic fluorescence decrease and fluorescence polarization increase of PGEk under oligonucleotide titration. Adsorption isotherms were plotted in Scatchard coordinates. We have shown that adsorption of the first two PGEk molecules on TMO and TMS occurs noncooperatively with the high association constants K1(TMO) = (7 +/- 1) x 10(7) M(-1) and K1(TMS) = (3 +/- 0.5) x 10(7) M(-1), respectively. Further adsorption up to 5-6 PGEk molecules on TMO occurrs cooperatively with still high association constant K2(TMO) = (4.0 +/- 1.5) x 10(6) M(-1). TMS oligonucleotide binds the third PGEk molecule rather weakly, K2(TMS) = (8 +/- 2) x 10(5) M(-1). CD spectral analysis revealed that G-quadruplex structure formed by TMO have undergone a partial unfolding by binding of PGEk molecules while single-stranded structure formed by TMS was not affected by binding PGEk. Thus, the tertiary structure of DNA and the number of adsorbed PGEk molecules formed biologically active compounds PGEk: TMO and PGEk: TMS were defined, which are able to penetrate through the membrane of proliferating cells and to suppress their growth.
We have performed a conformational analysis of DNA double helices poly(dA).poly(dT) with parallel directed backbone strands in heteronomic model frames. All possible models of base pairs and various mutual orientation of base pair and sugarphosphate backbones were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of parallel double polynucleotides were calculated. The dependences of conformational energy on the base pair structure were studied.
Conformational analysis of four stranded DNA helices poly(dT).poly(dA).poly(dA).poly(dT) with parallel arrangement of the identical sugar-phosphate chains connected by twofold symmetry has been performed. All possible models of symmetrical base binding were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of four stranded polynucleotides were calculated. The dependences of conformational energy on the base complex structure and mutual orientation of the poly(dA).and poly(dT) chains were studied. Possible biological functions of four stranded helices are discussed.
Conformational analysis of double helices of DNA with parallel arranged sugar-phosphate chains connected by twofold symmetry has been performed. Homopolymers poly(dA).poly(dA), poly(dC).poly(dC), poly(dG).poly(dG) and poly(dT).poly(dT) were studied. For each of the homopolymers all variants of H-bond pairing were checked. The maps of closing of sugar-phosphate backbone were previously computed. By the optimization of potential energy the dihedral angles and helix parameters of relatively stable conformations of parallel stranded polynucleotides were calculated. The dependence of conformational energy on the nucleic base character and the base pair type were studied. Two main conformational regions for favourable "parallel" helix of polynucleotides were found. The former of these two regions coincide with the region of typical conformational parameters of B-DNA. On an average the conformational energy of "parallel" DNA is close to the energy of canonic "antiparallel" B-DNA.
The thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3' (parAT), 3'-d(AT)5pO(CH2)5Opd(AT)5-5' (antiAT), 3'-d(A)10pO(CH2)6Op(T)10-3' (parA-T) and 3'd(A)10pOX X (CH2)6Opd(T)10-5' (antiA-T) in 0.01 M phosphate buffer at pH 7 in presence 0.1, 0.25, 0.5 and 1.0 M NaCl have been studied. It was shown that at lower temperature (0-20 degrees C) all oligomeres exist as complexes of two (canonic duplex) or four (eight) molecules of oligonucleotides, but at higher temperature (30-70 degrees C)- as hairpins with parallel (parAT and parA-T) of antiparallel (antiAT and antiA-T) orientation of chains. Thermodinamic parameters of separated strands-hairpins and hairpins--"low temperature complexes" transition were computated from the melting curves [A260 (T)] by nonlinear regression. AntiA-T was shown by ethidium bromide binding to exist at low strength (0.01 M phosphate buffer without NaCl) as four-stranded complex from two antiparallel double stranded helices parallely oriented and bonded by satisfy hydrogen-bond of groups not involved in WC-pairing. At higher ionic strength the two of such tetramers was conjugated by hydrophobic interaction into octamers. We speculate that four-stranded complexes serves to bring together, and zipper up two antiparallel double stranded helices at replication of DNA, cross-over of gomologues chromosomes and other biochemically important processes.
The dependence of UV and CD spectra of oligonucleotide 3'-d(ApTpApTpApTpApTpApTp)-O(CH2)6O-5'-(pApTpApTpApTpApTp ApT) (eicosamer) in aqueous solution at pH 7 in the presence of 0.5 M NaCl on temperature and concentration was studied. It was shown that the eicosamer in concentrations below 5.10(-4) M forms a parallel stranded hairpin. From the thermal denaturation profile the thermodynamic parameters of parallel hairpin formation were determined. The values of delta H0, delta S0 and Tm were -90 +/- 8 kJ/mol, -300 +/- 20 J.mol-1.K-1 and 40.5 degrees C, respectively. The CD spectra of the parallel helix differ from those of B-form DNA by reduction of extreme magnitude at approximately 265 nm and appearance of a negative effect at approximately 285 nm.
Self-complementary oligodeoxynucleotides: GGACCCGGGTCC, GGA4mCCCGGGTCC, GGA5mCCCGGGTCC, CGCGCGCG, CG4mCGCGCG, CG5mCGCGCG were synthetized to study the contribution of methyl groups into the energetics of the three known cooperative transitions in DNA: helix-coil, B-A and B-Z With the use of circular dichroism and absorbtion methods the profiles of the above transitions were obtained by variation of temperature (helix-coil), trifluoroethanol fraction (B-A), NaCl and trifluorethanol contents (B-Z). On the basis of the transition widths and shifts of the transition points due to the methylations the energetics of the methyl groups was estimated. 5mC stabilizes the B form relatively the A form by 0.33 kcal/mol; while 4mC by 0.5 kcal/mol. In the B-Z transition 5 mC stabilizes the Z form by 0.28 kcal/mol relatively the B form; 4mC stabilizes also the Z form although by 0.14 kcal/mol only. Thus, these naturally occurring modifications could modulate substantially the ability of a DNA piece to shift into the A or Z form.
Explore the source record for details and available documents.