Search PubMed⌕ Search

Biomedical subjects

A Hirata

Publications and source records attributed to A Hirata.

At least 37 records · Page 2Linked to original sources
PubMed2003

Effects of SRT and DO on N2O reductase activity in an anoxic-oxic activated sludge system.

Nitrous oxide (N2O) is emitted from wastewater treatment processes, and is known to be a green house gas contributing to global warming. It is thus important to develop technology that can suppress N2O emission. The effects of sludge retention time (SRT) and dissolved oxygen (DO) on N2O emission in an anoxic-oxic activated sludge system were estimated. Moreover, the microbial community structure in the sludge, which plays an important role in N2O suppression, was clarified based on nitrous oxide reductase (nosZ) gene analysis by molecular biological techniques. The results showed that under low SRT conditions, nitrification efficiency was reduced and the N2O emission rate in the oxic reactors was increased. It was also observed that N2O emission was enhanced under low DO conditions, where the available oxygen is insufficient for nitrification. Moreover, molecular analysis revealed that the clones identified in this study were closely related to Ralstonia eutropha and Paracoccus denitrificans. The fact that the identified sequences are not closely related to known culturable denitrifier nosZ sequences indicates a substantial in situ diversity of denitrifiers contributing to N2O suppression, which are not reflected in the cultivatable fraction of the population. The further application of these new molecular techniques should serve to enhance our knowledge of the microbial community of denitrifying bacteria contributing to N2O suppression in wastewater treatment systems.

Air Pollution↗
PubMed2002

Detection and quantification of expression of amoA by competitive reverse transcription-pCR.

Ammonia oxidation by chemolithoautotrophic ammonia-oxidizing bacteria is an important step in the biological nitrogen removal process. The first conversion step, the oxidation of ammonia to hydroxylamine is catalyzed by ammonia monooxygenase (AMO). To investigate the activity of ammonia oxidation, mRNA (designated as amoA) encoding a subunit of AMO was quantified by competitive reverse transcription (RT)-PCR. As a result, it was possible to detect and quantify amoA expression in cultured Nitrosomonas europaea and even complex microbial communities such as nitrifying bacterial aggregates by competitive RT-PCR. It was estimated that amoA concentration in cultured N. europaea was 2.3 x 10(8) copies x ml(-1). Additionally, it was calculated that the copy number of amoA in nitrifying bacterial aggregates was 1.0 x 10(12) copies x ml(-1) (5.1 x 10(10) copies x mg(-1)-dry weight). On the other hand, amoA expression in the natural activated sludge in a household Gappei-Johkaso was undetectable, whereas 16S rRNA of ammonia-oxidizing bacteria was detected by RT-PCR. Then, four days cultivation of this sludge in inorganic artificial wastewater resulted in increasing amoA expression to a quantifiable amount by competitive RT-PCR. In conclusion, the competitive RT-PCR was effective to investigate the expression of amoA as an indicator of ammonia oxidation activity by autotrophic ammonia-oxidizing bacteria.

Ammonia↗
PubMed2002

PCR-DGGE analysis of denitrifying bacteria in a metallurgic wastewater treatment process.

The wastewater generated from the processes of recovering precious metals from industrial wastes contains high concentrations of acids such as nitric acid and of salts. Biological nitrogen removal from this wastewater was attempted by using a circulating bioreactor system equipped with an anoxic packed bed or an anoxic fluidized bed and an aerobic three-phase fluidized bed. The system was found to effectively remove nitrogen from the diluted wastewater (T-N; 1,000-4,000 mg litre(-1)). The microbial population structure of activated sludge in an anoxic reactor was analyzed by denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S ribosomal DNA (rDNA) fragments. DGGE analysis under different operating conditions demonstrated the presence of some distinguishable bands in the separation pattern, which were most likely derived from many different species constituting the microbial communities. Furthermore, the population diversity varied in accordance with the nitrate-loading rate, water temperature and reactor condition. Some major DGGE bands were excised, reamplified and directly sequenced. It was revealed that the dominant population in the anoxic reactor were affiliated with the beta subclass of the class Proteobacteria.

Bioreactors↗
PubMed2002

Real-time monitoring of ammonia-oxidizing activity in a nitrifying biofilm by amoA mRNA analysis.

Ammonia monooxygenase encoding mRNA (amoA mRNA) transcription in the wastewater treatment process was investigated using reverse transcription PCR (RT-PCR) as the model indicating specific function and activity in nitrifying processes. The dynamic response of amoA mRNA transcription and ammonia-oxidizing activity to the change of environmental conditions such as pH and concentration of ammonia was examined to determine the inductive factor and the inhibitor for amoA mRNA expression. Furthermore, we semiquantitatively investigated the response of amoA mRNA transcription to the pH fluctuation in a continuous fed nitrifying reactor. As a result, amoA mRNA oriented analysis enabled real-time assay of ammonia-oxidizing activity within 2 h as a response time. In contrast, rRNA and amoA encoding DNA were constantly detected at almost the same amount throughout the experiment. mRNA transcription was regulated by the many environmental conditions: ammonia seems to be one of the strong inducers for transcription of amoA mRNA, whereas low pH seems to be a strong inhibitor. These factors simultaneously affected the mRNA transcription and enzymatic activity leading to the complex phenomena of ammonia-oxidizing activity and amoA mRNA transcription in the continuous feeding reactors.

Ammonia↗
PubMed2002

Inhibition effect of chlorine ion on hydroxyl radical generation in UV-H2O2 process.

UV-H2O2 process is widely used as an advanced oxidation process (AOP) for the treatment of chlorine volatile organic compounds (CVOCs) such as dichloromethane (DCM) with strong oxidativity of hydroxyl radical generated from photolysis of H2O2. The result of DCM degradation rate at different initial concentrations in UV-H2O2 processes indicated the inhibition effect of produced chlorine ions on DCM oxidation processes, because the first-order degradation rate constant increased with lower initial concentrations. A spin trapping adduct of hydroxyl radical with 5,5-dimethyl-1-pyrroline-n-oxide (DMPO) was quantified by ESR spectrometer after UV irradiation in the presence of different amounts of chlorine ion, and as a result, the chlorine ion was found to act as a hydroxyl radical scavenger, which resulted in decreasing DCM degradation rate. An UV-H2O2 reactor equipped with ion exchangers for removing chlorine ion achieved higher DCM degradation rate than that without ion exchangers.

Chlorine↗
PubMed2002

Characterization of microbial community in nitrogen removal process of metallurgic wastewater by PCR-DGGE.

The metallurgic wastewater generated from the processes of recovering precious metals from industrial wastes contains high concentrations of nitrogen compounds such as ammonia and nitric acid and of salts such as sodium chloride and sodium sulfate. Biological nitrogen removal from this wastewater was attempted by a circulating bioreactor system equipped with an anoxic packed bed and an aerobic fluidized bed. The anoxic packed bed of this system was found to effectively remove nitrite and nitrate from the wastewater by denitrification at a removal ratio of 97%. As a result of denitrification activity tests at various NaCl concentrations, the sludge obtained from the anoxic packed bed exhibited accumulation of nitrite at 5.0 and 8.4% NaCl concentrations, suggesting that the reduction of nitrite is the key step in the denitrification pathway under hypersaline conditions. The microbial community analysis by denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S ribosomal DNA (rDNA) fragments revealed that the community diversity varied in accordance with water temperature, nitrate-loading rate and ionic strength. When particular major DGGE bands were excised, reamplified and directly sequenced, the dominant species in the anoxic packed bed were affiliated with the beta and gamma subclasses of the class Proteobacteria such as Alcaligenes defragrans and Pseudomonas spp., respectively.

Bioreactors↗
PubMed2002

Community analysis of nitrifying bacteria in an advanced and compact Gappei-Johkasou by FISH and PCR-DGGE.

Fluorescent in situ hybridization (FISH) method with 16S rRNA-targeted oligonucleotide probes was used for quantitative estimation of ammonia oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB) in a Johkasou. Although the occupation ratios of AOB and NOB increased as nitrification progressed, about one month later, the occupation ratios decreased, despite showing good nitrification ability. Furthermore, even when urea was added to the feeding wastewater to raise the amount of T-N, the occupation ratios of both nitrifying bacteria remained constant. For further investigation, denaturing gradient gel electrophoresis (DGGE) was used to study the community structure of AOB in the Johkasou. As a result, DGGE band patterns and following sequence analysis revealed that the community structure of AOB was complicated and changed during this experiment. It was suggested that even if the occupation ratio of AOB to eubacteria was constant, the majorities of AOB were changed through temperature and load fluctuation. The combination of FISH and PCR-DGGE provides new information that was not available by conventional cultivation-based methods.

Ammonia↗
PubMed2001

Candesartan inhibits carotid intimal thickening and ameliorates insulin resistance in balloon-injured diabetic rats.

This study investigates the effects of candesartan, an angiotensin II type 1 receptor blockade, on carotid arterial intimal thickening and glucose tolerance in balloon-injured male Wistar fatty rats and their littermates (Wistar lean rats). Candesartan was orally administered to 12-week-old rats for 21 days, and age-matched rats without the agent were used as the respective controls. Balloon catheterization in the left common carotid artery was performed on day 7, and the artery was removed on day 14 for histological analysis. Compared with the area ratios of the neointima/media in fatty rats without treatment, the ratios in fatty rats treated with candesartan at 1 mg. kg(-1). d(-1) and lean rats without treatment were significantly decreased to 65%; on the other hand, the ratios of fatty rats treated with candesartan at 10 mg. kg(-1). d(-1) and lean rats treated with 1 mg. kg(-1). d(-1) were reduced to 35%, and those of lean rats treated with 10 mg. kg(-1). d(-1) were reduced to 28%. The administration of candesartan also decreased the level of plasma glucose time- and dose-dependently in fatty rats. In an intragastric glucose load, the levels of both glucose and insulin at 30 and 60 minutes were significantly decreased when fatty rats were treated with candesartan at 10 mg. kg(-1). d(-1). In cultured vascular smooth muscle cells from fatty rats, insulin-stimulated Akt (New England Biolabs) phosphorylation and 2-deoxy-D-glucose uptake were inhibited to 59% and 68%, respectively, by angiotensin II, but the effects were ameliorated by the addition of 10(-7) mol/L candesartan. We conclude that candesartan could be effective for the suppression of vascular smooth muscle cell growth dose-dependently in Wistar fatty and lean rats. Furthermore, the agent could improve insulin resistance in Wistar fatty rats.

Angiotensin Receptor Antagonists↗
PubMed2001

The Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP) can function as a dominant suppressor of Bax-induced cell death of yeast.

We identified genes based on screening of an Arabidopsis cDNA library for functional suppressors of mouse Bax-induced cell death of yeast cells. Interestingly, the cDNA encoding AtEBP, known as Arabidopsis thaliana ethylene-responsive element binding protein, was isolated numerous times in the functional screen (82% of all suppressors). Full-length AtEBP and its localization to the nucleus were essential for the suppression of Bax-induced cell death. Morphological abnormality of intracellular network that is a hallmark of Bax-induced cell death was attenuated by expression of AtEBP.

Animals↗
PubMed2001

Mammalian Bax-induced plant cell death can be down-regulated by overexpression of Arabidopsis Bax Inhibitor-1 (AtBI-1).

We recently isolated the AtBI-1 (Arabidopsis Bax Inhibitor-1) gene, the expression of which suppressed Bax-induced cell death in yeast. To determine whether the same is true in the plant system, transgenic Arabidopsis plants overexpressing Bax protein under a dexamethasone (DEX)-inducible promoter were generated. On DEX treatment, such transgenic plants exhibited marked cell death at the whole-plant level, cell shrinkage, membranous destruction, and other apoptotic phenotypes. Transgenic Bax plants were retransformed with a vector containing the AtBI-1 gene (tagged with green fluorescent protein) under the control of the cauliflower mosaic virus 35S promoter. Plants expressing both Bax and AtBI-1 were able to maintain growth on DEX-treatment by sustaining intracellular integrity. Thus, we present here direct genetic evidence that the plant antiapoptotic protein AtBI-1 is biologically active in suppressing the mammalian Bax action in planta.

Animals↗
PubMed2001

Novel kinetic analysis of enzymatic dipeptide synthesis: effect of pH and substrates on thermolysin catalysis.

The point of maximum activity is specific to a particular substrate-enzyme system but may vary with different substrates and the same enzyme. The specificity of enzymes has, however, been generally reported only at their "optimal" pH. In this article, we introduce the Michaelis-Menten equation taking pH into account, and apply it to the pH-activity profile of the thermolysin-catalyzed dipeptide synthesis. It has been reported to date that the pH-activity profile of thermolysin follows a bell-shaped curve with a maximal activity at or near pH 7.0. The profiles obtained in this study, however, indicated that the optimal pH varied from 5.8 (for F-AspPheOMe) to 7.3 (for Z-ArgPheOMe), and the order of thermolysin activity was greatly dependent on the pH of reaction media. We have succeeded in evaluating the substrates-induced change of the dissociation states of the active site of thermolysin using the hydrophobicity of substrates. We have obtained apparent kinetic parameters which are independent of the pH of reaction media. The apparent specificity of thermolysin which were independent of pH of the reaction media was in order L-Leu > L-Asp > L-Arg > L-Ala > L-Gly > L-Val and Z > Boc = F at P1 and P2 positions, respectively.

Amino Acids↗
PubMed2001

Ultracytochemical study of medullary bone calcification in estrogen injected male Japanese quail.

Fine structural and cytochemical studies were performed to clarify the pattern of medullary bone calcification, specifically in relation to sulfated glycosaminoglycans, by using estrogen-induced medullary bone of male Japanese quails. Tibiae were collected at 4 and 7 days after estrogen treatment. Medullary bone had developed inward toward the marrow cavity, and calcification had begun near the cortical bone and deeper parts of the trabeculae, accompanied by wide osteoid at extending tips and surface areas of the trabeculae. Sulfated glycosaminoglycans, detected by high iron diamine (HID), were distributed in the matrix in a pattern similar to that of calcified matrix of the trabeculae. Cortical bone was negatively stained by HID. In undecalcified specimens, calcified nodules were seen in areas undergoing calcification. Globular structures composed of fine filamentous materials, a marginal dense layer, and central core, were also observed in the matrix of decalcified specimens. Both the calcified nodules and globular structures showed the same distribution pattern, i.e., they were dispersed at surface areas and coalesced in the deeper areas of the matrix. The globular structures were exclusively positive for HID-thiocarbohydrazide-silver protein (HID-TCH-SP) stain, indicating the localization of sulfated glycosaminoglycans. These results strongly suggest that medullary bone calcification progresses by the coalescence of calcified nodules and that sulfated glycosaminoglycans play an important role for the regulation of globular calcification.

Animals↗
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Activation of the Ras-cAMP signal transduction pathway inhibits the proteasome-independent degradation of misfolded protein aggregates in the endoplasmic reticulum lumen.

Many kinds of misfolded secretory proteins are known to be degraded in the endoplasmic reticulum (ER). Dislocation of misfolded proteins from the ER to the cytosol and subsequent degradation by the proteasome have been demonstrated. Using the yeast Saccharomyces cerevisiae, we have been studying the secretion of a heterologous protein, Rhizopus niveus aspartic proteinase-I (RNAP-I). Previously, we found that the pro sequence of RNAP-I is important for the folding and secretion, and that Deltapro, a mutated derivative of RNAP-I in which the entire region of the pro sequence is deleted, forms gross aggregates in the yeast ER. In this study, we show that the degradation of Deltapro occurs independently of the proteasome. Its degradation was not inhibited either by a potent proteasome inhibitor or in a proteasome mutant. We also show that neither the export from the ER nor the vacuolar proteinase is required for the degradation of Deltapro. These results raise the possibility that the Deltapro aggregates are degraded in the ER lumen. We have isolated a yeast mutant in which the degradation of Deltapro is delayed. We show that the mutated gene is IRA2, which encodes a GTPase-activating protein for Ras. Because Ira2 protein is a negative regulator of the Ras-cAMP pathway, this result suggests that hyperactivation of the Ras-cAMP pathway inhibits the degradation of Deltapro. Consistently, down-regulation of the Ras-cAMP pathway in the ira2 mutant suppressed the defect of the degradation of Deltapro. Thus, the Ras-cAMP signal transduction pathway seems to control the proteasome-independent degradation of the ER misfolded protein aggregates.

Aspartic Acid Endopeptidases↗
PubMed2001

Multicopy suppressors of the sly1 temperature-sensitive mutation in the ER-Golgi vesicular transport in Saccharomyces cerevisiae.

Saccharomyces cerevisiae Sly1 protein is a member of the Sec1/Munc18-family proteins, which are essential for vesicular trafficking, but their exact biological roles are yet to be determined. A temperature-sensitive sly1 mutant arrests the vesicular transport from the ER to Golgi compartments at 37 degrees C. We screened for multicopy suppressor genes that restore the colony formation of the sly1(ts) mutant to discover functionally interacting components. The suppressor genes obtained were classified as: (1) those that encode a multifunctional suppressor, SSD1; (2) heat shock proteins, SSB1 and SSB2; (3) cell surface proteins, WSC1, WSC2 and MID2; (4) ER-Golgi transport proteins, USO1 and BET1; and (5) an as-yet-uncharacterized protein, HSD1 (high-copy suppressor of SLY1 defect 1). By epitope tagging of the gene product, we found that Hsd1 protein is an ER-resident membrane protein. Its overproduction induced enlargement of ER-like membrane structures.

Amino Acid Sequence↗
PubMed2001

Abnormalities of synapses and neurons in the hippocampus of neuropsin-deficient mice.

In the present study, we produced null-mutant mice of neuropsin, an extracellular matrix serine protease, to examine the neural functions of this protein particularly in the hippocampus. Golgi-Cox impregnation and Nissl-staining revealed morphological change of cell soma in the mutant mice compared to wild-type mice. However, Golgi-Cox impregnation revealed no apparent change in the dendritic arborization and spine density. Quantitative electronmicroscopic analysis revealed that number of asymmetrical synapses were significantly decreased in the stratum radiatum, the major terminal field of Schaffer-collaterals, whereas free boutons still holding synaptic vesicles but with no synaptic specialization were increased in number in the same microscopic fields. An increased number of parvalbumin-immunoreactive cells (known as fast spiking cells) in mutant was also observed. These results strongly suggest that neuropsin is involved in connectivity of a group of CA1 synapses and consequently in the hippocampal networking.

Animals↗
PubMed2001

Expression of dystroglycan complex in satellite cells of dorsal root ganglia.

In Schwann cells, the transmembrane glycoprotein beta-dystroglycan composes the dystroglycan complex together with the extracellular glycoprotein alpha-dystroglycan, which binds laminin-2 (alpha2/beta1/gamma1), a major component of the Schwann cell basal lamina. In the Schwann cell cytoplasm, beta-dystroglycan is anchored to a dystrophin isoform, Dp116. In this study, we investigated the expression of beta-dystroglycan, Dp116 and the laminin-alpha2 chain in satellite cells of rat dorsal root ganglia (DRGs). Immunohistochemical study showed that immunoreactivities for beta-dystroglycan and Dp116 were both localized to the outer rim of neuron-satellite cell and axon-Schwann cell units, indicating that both satellite and Schwann cells expressed these proteins in DRGs. Immunoreactivity for the laminin-alpha2 chain was detected in a similar location, indicating that the basal lamina surrounding satellite and Schwann cells in DRGs contained laminin-2. Ultrastructurally, immunoreactivity for the cytoplasmic domain of beta-dystroglycan as well as that for Dp116 was most intense in the cytoplasm just underlying the outer membrane of satellite cells. The immunoreactivity for laminin was associated with the outer surface of those cells, suggesting that it was localized in the surrounding basal lamina. These results indicate that the dystroglycan complex is expressed in the satellite cell outer membrane and involved in the adhesion with the basal lamina through the interaction with laminin-2.

Animals↗