Search PubMed⌕ Search

Biomedical subjects

A F Markham

Publications and source records attributed to A F Markham.

At least 217 records · Page 12Linked to original sources
PubMed1982

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system.

Base Composition↗
PubMed1982

Synthesis of some 5'-amino-2',5'-dideoxy-5-iodouridine derivatives and their antiviral properties against herpes simplex virus.

In an attempt to improve the antiviral efficacy of 5'-amino-2',5'-dideoxy-5-iodouridine (AIdU) the N-acetyl and N,3'-O-diacetyl derivatives were prepared. N-Acetylation of AIdU increased its ability to inhibit the phosphorylation of thymidine by the deoxypyrimidine kinase of herpes simplex virus type 1 (HSV1) while diacetylation had the converse effect. The affinity of the corresponding compounds containing uracil or thymine for virus deoxypyrimidine kinase was also determined. A range of N-acyl-, N-sulphonyl- and N,3'-O-diacyl- derivatives of AIdU were synthesized; enhanced inhibition of deoxypyrimidine kinase by a number of these compounds was observed. The previous observation that 5'-azido-2',5'-dideoxy-5-iodouridine has antiherpetic activity in vivo led us to investigate its 3'-O-acetyl derivative as well as the corresponding compound containing uracil. None of the derivatives described showed antiviral activity in cell culture against HSV1; acylation failed to enhance the potency of AIdU against HSV1 in vivo.

Acetylation↗
PubMed1982

Isolation of cDNA clones for the human complement protein factor B, a class III major histocompatibility complex gene product.

cDNA clones corresponding to a major histocompatibility class III antigen, the complement protein factor B, have been isolated from a human adult liver cDNA library. The clones, ranging in size from 1.0 to 2.3 kilobases, were identified by direct hybridization with two synthetic oligonucleotide mixtures. Two regions of the factor B amino acid sequence, each with minimal ambiguity in codon assignment, were chosen for synthesis of the oligonucleotides. The sequences of two clones have been partially determined. They contain coding information for the amino acid sequence of the Bb fragment of factor B and the entire 3' -untranslated region.

Adult↗
PubMed1981

Total synthesis of a human leukocyte interferon gene.

A 514-base pair fragment of double-stranded DNA coding for human interferon-alpha 1 (166 amino acid residues), and containing initiation and termination signals plus appropriate restriction enzyme sites for plasmid insertion, has been totally synthesized. The synthesis involved preparation of 66 oligodeoxyribonucleotides, ranging in size from 14 to 21 residues, plus 1 deoxydecanucleotide, by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. After ligation of the synthetic gene to a plasmid vector and transformation of Escherichia coli, clones containing the anticipated gene sequence were obtained.

Base Sequence↗
PubMed1981

Total synthesis of a RNA molecule with sequence identical to that of Escherichia coli formylmethionine tRNA.

A RNA molecule has been synthesized that is identical in sequence to Escherichia coli tRNAfMet except that it lacks the base modifications present in the E. coli tRNA. This was achieved by enzymatic joining of chemically synthesized oligonucleotides with chain lengths of 3-10 which were synthesized by the phosphodiester or phosphotriester method. First, quarter molecules of tRNA were constructed by joining of chemically synthesized fragments with RNA ligase. The 5'-quarter molecule (bases 1-20) served as an acceptor in joining reactions with the 3',5'-bisphosphorylated donor molecule (bases 21-34). The 5'-half molecule thus obtained was treated with phosphatase and joined to the 3'-half molecule which was prepared by ligation of the other quarter molecules (bases 35-60, acceptor; bases 61-77, donor) followed by 5'-phosphorylation with polynucleotide kinase. The synthetic tRNA was characterized by oligonucleotide pattern and was partially active in aminoacylation with E. coli methionyl-tRNA synthetase.

Base Sequence↗
PubMed1980

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

Base Sequence↗
PubMed1980

Total synthesis of tRNAfMet.

Oligonucleotides corresponding to the E. coli tRNAfMet fragments and their analogs have been synthesized by the phosphodiester or phosphotriester method. The nascent fragments were joined by using RNA ligase to yield a total tRNA molecule. The synthetic molecule was tested its ability to accept methionine in the presence of purified methionyl-tRNA synthetase from E. coli. The charged tRNA and the hydrolyzed methionine were isolated by gel filtration. The discharged tRNA was characterized by nearest neighbor analysis and 5'-end analysis.

Base Sequence↗
PubMed1979

Influence of terminal 3' phosphates or 2',3'-cyclic phosphates on the conformations of oligoriboadenylates, oligoribocytidylates, and the corresponding monomers.

The circular dichroism spectra of chemically synthesized adenylate and cytidylate dinucleotides and trinucleotides bearing terminal 3' phosphates have been compared under a variety of conditions with the spectra obtained from the corresponding oligomers with 2',3'-terminal cyclic phosphate groups. Similar comparisons for the mononucleotides are also presented. Although the base stacking of an oligomer with a terminal cyclic phosphate might be expected to be greater than that of the corresponding oligomer with a 3' phosphate from charge repulsion considerations, the magnitudes of the Cotton effects in the former class are always considerably smaller than those in the latter class. This suggests a decreased stacking. The implications of these observations are discussed in light of the compelling crystallographic evidence that cytidine 2',3'-cyclic phosphate adopts an unusual sugar puckering and the syn conformation.

Adenosine Monophosphate↗
PubMed1979

Rapid chemical synthesis and circular dichroism properties of some 2'-5'-linked oligoriboadenylates.

Specific synthesis of some oligoadenylates including A2'p5'A2'p5'Ap(2'), the 2'-phosphorylated oligoribonucleotide core of the recently discovered protein synthesis inhibitor pppA2'p5'A2'p5'A is described using a novel solid-phase method. The CD spectra of A2'p5'Ap(2'), A2'p5'A2'p5'Ap(2') and A2'p5'A2'p5'A (derived by treatment of the phosphorylated synthetic trimer with E. coli alkaline phosphatase) are presented. Comparison of the latter spectrum with that of A2'p5'A2'p5'A obtained similarly from a biologically derived sample of pppA2'p5'A2'p5'A provides further evidence that this molecule is in fact the first naturally-occurring 2'-5'-linked oligoribonucleotide.

Adenosine↗
PubMed1979

Synthesis of the nascent strand of tRNAfMet from E coli.

Oligonucleotides corresponding to the total tRNAfMET FROM E. coli have been synthesized. These fragments were joined by using RNA ligase to yield quarter molecules. The 5'-quarter molecule showed 84% amino acid acceptor activity when it was combined with the natural three quarter molecule.

Base Sequence↗
PubMed1978

Joining of 3'-modified oligonucleotides by T4 RNA ligase. Synthesis of a heptadecanucleotide corresponding to the bases 61--77 from Escherichia coli tRNAfMet.

Chemically synthesized fragments corresponding to the 3' end of tRNAfMet from Escherichia coli were joined by T4-induced RNA ligase to yield a heptadecanucleotide (bases 61--77). The 3' terminus of C-C-A was modified by introduction of the ethoxymethylidene group to prevent intra- and intermolecular self-joining reactions at the 3' end. The terminal trimer was phosphorylated using polynucleotide kinase and joined to C-A-A with RNA ligase. The hexamer [C-A-A-C-C-A(ethoxymethylidene)] corresponding to bases 72--77 was obtained in a yield of 60%. An undecanucleotide (bases 61--71) which had been synthesized in a yield of 34% by similar enzymatic joining of U-C-C-G-G to pC-C-C-C-C-G was allowed to react with the 5'-phosphorylated hexamer (bases 72--77) using an excess of RNA ligase to yield the heptadecanucleotide U-C-C-G-G-C-C-C-C-C-G-C-A-A-C-C-A (bases 61--77). The product was identified by homochromatography and nearest neighbor analysis.

Base Sequence↗
PubMed1977

Joining of synthetic ribotrinucleotides with defined sequences catalyzed by T4 RNA ligase.

RNA ligase catalyzed the joining of pC-C-Ap with C-A-A in the synthesis of C-A-A-C-C-Ap, which has the sequence of the Escherichia coli tRNAfMet 3'-end. pC-C-A was also shown to be joined to C-A-A without any undesired self-polymerization. Joining of pC-C-A to various synthetic ribotriplets, such as C-C-A, A-A-A, C-C-C, U-U-U, U-A-G, C-C-G and U-U-C, was performed as well as joining to the partially substituted trimers with a photolabile o-nitrobenzyl group, C-Anbzl-A and C-C-Anbzl. The yields were C-A-A-C-C-A (69%), C-C-A-C-C-A (38%), A-A-A-C-C-A (66%), C-C-C-C-C-A (71%), U-U-U-C-C-A (50%), U-A-G-C-C-A (23%), C-C-G-C-C-A (43%) and U-U-C-C-C-A (46%). C-Anbzl-A was a slightly poorer acceptor than C-A-A and C-C-Anbzl did not serve as an acceptor. Recognition of acceptor molecules by RNA ligase is discussed in terms of affinity of oligonucleotides for the enzyme.

Coliphages↗
PubMedDate not supplied

Highly polymorphic minisatellite DNA probes. Further evaluation for individual identification and paternity testing.

Reliable and reproducible protocols have been developed for the routine DNA fingerprinting of individuals using the highly polymorphic minisatellite DNA probes 33.15 and 33.6. Comparison of DNA fingerprinting from 50 individuals has generated further data on the level of band sharing in the DNA fingerprints of unrelated individuals, as well as the number of bands scorable in individuals. These results are consistent with previous studies. The occurrence of mutant bands in offspring has been examined in over 100 families. Further support is presented for the Mendelian inheritance of minisatellite loci and for lack of significant allelism and linkage between different variable DNA fragments detected in a human DNA fingerprint.

Alleles↗