Search PubMed⌕ Search

Biomedical subjects

A Cabello

Publications and source records attributed to A Cabello.

At least 19 recordsLinked to original sources
PubMed2006

Classification and scoring systems in myelodysplastic syndromes: a retrospective analysis of 311 patients.

The main objective of this study was to evaluate the role of the recent World Health Organization (WHO) classification for assessing prognosis in patients with myelodysplastic syndromes (MDS). To this effect, we analyzed the prognostic impact of the WHO and French-American-British (FAB) morphologic classifications and of four different scoring systems in a series of 311 patients with primary MDS diagnosed between October 1990 and June 2001. Both the FAB and WHO classifications identified groups with different prognoses (p<0.0001), those presenting refractory anemia (RA) and refractory anemia with ringed sideroblasts (RARS) showing the best prognosis. The WHO classification subdivided RA into RA with only red cell dysplasia, and refractory cytopenia with multilineage dysplasia (RCMD), and RARS into RARS plus refractory cytopenia with multilineage dysplasia and ringed sideroblast (RCMD-RS). In our population, we have shown that the two subtypes characterized by dysplasia affecting exclusively the erythroid population (RA and RARS) have a better prognosis, with a median survival of 122.2 and 81.9 months, respectively, than those with multilineage dysplasia (RCMD and RCMD-RS) with a median survival of 32.3 and 43.2 months, respectively. There were no significant differences in median survival comparing RA with RAS (p<0.95), or comparing RCMD with RSCMD (p<0.97). Besides, the four scoring systems discriminated our MDS patients in terms of survival, and an increase in prognostic capacity was achieved on adding the score to the morphological classifications. Risk scoring had a greater prognostic impact than the FAB and WHO classifications. Prognostic scoring systems may be an important tool for risk stratification in hematological practice, and add significance to morphological classification. Combined application of the WHO classification and score system is useful for improving the identification of patients with a poorer prognosis. The WHO classification establishes more homogeneous subcategories than the FAB classification and is also able to identify groups with different prognoses.

Adult↗
PubMed2006

Complete surgical resection of high-grade astroblastoma with long time survival: case report and review of the literature.

Astroblastoma is a rare glial neoplasm of unknown origin and uncertain prognosis. It usually presents in young adults as a well circumscribed hemispheric mass, often associated with a cystic component. The histological features of astroblastoma are the presence of typical astroblastic perivascular pseudorosettes and perivascular hyalinization. Two different subtypes of astroblastoma have been defined based upon histological characteristics. Prognosis, however, sometimes is in contradiction with the pathological appearance and seems to be more closely related to the grade of surgical resection. We present a new case of a patient with a high-grade astroblastoma with a long survival time, in whom complete surgical resection was confirmed by an early postoperative MRI.

Adult↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2005

Autosomal dominant congenital fibre type disproportion: a clinicopathological and imaging study of a large family.

Congenital fibre type disproportion (CFTD) is considered a non-progressive or slowly progressive muscle disease with relative smallness of type 1 fibres on pathological examination. Although generally benign, CFTD has a variable natural course and severe progression has been observed in some patients. The pathogenesis of the disorder is unknown and many authors consider CFTD a syndrome with multiple aetiologies rather than a separate clinical entity. A positive family history has been reported in about 40% of cases, but the inheritance pattern is not clear. Both autosomal recessive and dominant modes of inheritance have been suggested. The present paper describes a large, multigenerational kindred that has an inherited myopathy fulfilling the histological criteria of CFTD, with autosomal dominant transmission and high penetrance. The clinical picture, remarkably similar in all affected family members, started in early infancy with mild limb muscle weakness. There was slow progression of symptoms into adulthood, with moderate to severe, mainly proximal, muscle weakness without loss of ambulation. Muscle biopsy from two affected individuals demonstrated predominance of small type 1 muscle fibres without other significant findings. Nerve conduction studies were normal and needle electromyography showed a myopathic pattern. MRI examination performed on three patients from successive generations showed involvement of proximal limb and paraspinal muscles. The clinical and pathological homogeneity in the present family, together with the lack of additional histological abnormalities after decades of disease progression in two affected individuals, supports this being a distinct myopathy with fibre type disproportion. Whether the disease in this family can be regarded as a form of the congenital myopathy known as CFTD or rather a unique condition sharing histological features with CFTD needs further investigation. This is, to our knowledge, the largest kindred with muscle fibre type disproportion reported to date. Our data confirm autosomal dominant inheritance, and this is the first MRI document of this disorder.

Adult↗
PubMed2005

HDM2 overexpression and focal loss of p14/ARF expression may deregulate the p53 tumour suppressor pathway in meningeal haemangiopericytomas. Study by double immunofluorescence and laser scanning confocal microscopy.

AIMS: To investigate the p53 pathway in meningeal haemangiopericytomas (MHPCs), p14/ARF, p53 protein expression and two wild-type (wt) p53-induced proteins (HDM2 and p21/WAF1) were studied in 18 MHPCs, 11 primary, four of them recurrent on one, one, two and four occasions. METHODS: Immunohistochemical detection of p14/ARF, p53, p21/WAF1, HDM2 and Ki67 proliferative index (PI) protein expression. RESULTS: Ki67 index was > 5% in eight out 18 cases (44.4%). The PI in recurrent cases increased with neoplastic progression. Simultaneous p53 and wt p53 transactivated gene (p21/WAF, HDM2) expression occurred in all cases. This argues against p53 mutation. HDM2 overexpression was observed in 10 cases (55.5%). Double-immunofluorescence staining and laser scanning confocal microscopy (LSCM) displayed HDM2 and p53 colocalization. This strongly suggests that HDM2 binds and inactivates p53 that could be pathogenic for MHPCs, by a different mechanism than point mutation. p14/ARF expression > 5% was observed in 12 cases (66.6%). A normal (diffuse) pattern of expression was seen in 13 cases (72.2%). Focal loss of expression was observed in five patients (27.7%): three primary cases and two recurrences. Therefore, p14/ARF down-regulation may also contribute to the development of MHPC. CONCLUSION: HDM2 overexpression, sometimes combined with focal loss of p14/ARF expression, may play a pathogenic role in MHPCs.

Cell Cycle Proteins↗
PubMed2003

Myoglobinuria and COX deficiency in a patient taking cerivastatin and gemfibrozil.

The authors describe a patient who presented with myoglobinuria after starting cerivastatin-gemfibrozil therapy. Muscle histochemistry revealed ragged-red fibers and cytochrome c oxidase negative (COX) fibers, and biochemistry showed a defect of COX activity. Immunoblot analysis showed a 60% reduction of COX I and COX II polypeptides. Cerivastatin myotoxicity might be related to a depletion of essential metabolites needed to anchor COX subunit I to mitochondrial membrane.

Aged↗
PubMed2003

Two pathogenic mutations in the mitochondrial DNA tRNA Leu(UUR) gene (T3258C and A3280G) resulting in variable clinical phenotypes.

We studied two patients with ragged-red fibers and combined defects of the mitochondrial respiratory chain in their muscle biopsy. One had mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes, and harbored a T3258C transition in the tRNA(Leu(UUR)) gene. The other showed myopathy plus cardiomyopathy and had an A3280G mutation in the same gene. Both mutations were heteroplasmic, abundant in muscle of the patients, less abundant in blood, and still less abundant in blood from their maternal relatives. In both patients, single muscle fiber analysis revealed greater abundance of mutant genomes in ragged-red fibers than in normal fibers, supporting the pathogenicity of both mutations.

Acidosis, Lactic↗
PubMed2003

Patterns of antimicrobial activities from soil actinomycetes isolated under different conditions of pH and salinity.

AIMS: To evaluate the patterns of the production of antimicrobial compounds by diverse collection of actinomycetes isolated from different geographies under alternative conditions of pH and salinity in the media. METHODS AND RESULTS: Actinomycetes were grouped based on their method of isolation and their phenotype diversity was determined by total fatty acid analysis. A total of 335 representative isolates, including 235 Streptomyces species and 100 actinomycetes from other taxa, were screened for the production of antimicrobial activities against a panel of bacteria, filamentous fungi and yeasts, including some of clinical relevance. Production of antimicrobial activities was detected in 230 strains. In the case of the genus Streptomyces, 181 antimicrobial activities (77% of the tested isolates) were recorded. The activities observed among the other actinomycetes taxa were lower (49% of the tested isolates). CONCLUSIONS: The results of this study support the idea that species of actinomycetes isolated in alternative selective conditions of pH and salinity present a significant capacity to produce compounds with antibacterial or antifungal activity. The best group of isolates in terms of production of active secondary metabolites was the one isolated in saline conditions. SIGNIFICANCE AND IMPACT OF THE STUDY: The results demonstrate that these actinomycetes strains isolated in alternative selective conditions of pH and salinity and collected from diverse geographical locations present a significant capacity to produce compounds with antibacterial or antifungal activity.

Actinobacteria↗
PubMed2003

Intestinal pseudo-obstruction and urinary retention: cardinal features of a mitochondrial DNA-related disease.

The syndrome of mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystemic disorder associated in most of the patients with an A to G transition at nucleotide position 3243 in the transfer RNA (tRNA)Leu(UUR) (A3243G) of the mitochondrial DNA. This syndrome is characterized by the preponderant involvement of skeletal muscle and central nervous system, but urinary or gastrointestinal symptoms are seldom documented. Here we report an unusual case of a 52-year-old woman with a clinical phenotype characterized by encephalopathy, left hemiparesis, urinary retention and gastrointestinal pseudo-obstruction. She had the classical A3243G mitochondrial DNA point mutation of MELAS syndrome. We also present a clinically heterogeneous multigenerational pedigree with several affected members in the maternal lineage.

Adult↗
PubMed2003

Microbial natural products as a source of antifungals.

The vast number and variety of chemotherapeutic agents isolated from microbial natural products and used to treat bacterial infections have greatly contributed to the improvement of human health during the past century. However, only a limited number of antifungal agents (polyenes and azoles, plus the recently introduced caspofungin acetate) are currently available for the treatment of life-threatening fungal infections. Furthermore, the prevalence of systemic fungal infections has increased significantly during the past decade. For this reason, the development of new antifungal agents, preferably with novel mechanisms of action, is an urgent medical need. A selection of antifungal agents in early stages of development, produced by micro-organisms, is summarized in this review. The compounds are classified according to their mechanisms of action, covering inhibitors of the synthesis of cell wall components (glucan, chitin and mannoproteins), of sphingolipid synthesis (serine palmitoyltransferase, ceramide synthase, inositol phosphoceramide synthase and fatty acid elongation) and of protein synthesis (sordarins). In addition, some considerations related to the chemotaxonomy of the producing organisms and some issues relevant to antifungal drug discovery are also discussed.

Animals↗
PubMed2003

Removal of indicator bacteria from municipal wastewater in an experimental two-stage vertical flow constructed wetland system.

The removal of sanitary indicator bacteria (total coliforms, faecal coliforms, and faecal streptococci) was studied in an experimental constructed wetland system consisting of (1) a 2-m3 three-chamber sedimentation tank, (2) a 5 m2 vertical flow constructed wetland, (3) a filter-unit with calcite aimed at removing phosphorus, and (4) a 10 m2 vertical flow constructed wetland. The indicator bacteria were enumerated before and after each unit of the wetland system during four monitoring episodes with different loading conditions. At a hydraulic loading rate of 520-1,370 mm/d, the first-stage vertical flow beds removed about 1.5 log-units of total coliforms, 1.7 log-units of faecal coliforms and 0.8 log-units of faecal streptococci. In the second stage bed receiving lower loadings both in term of concentration and quantity (260-690 mm/day), the eliminations were lower. It was not possible in the present study to identify any seasonal effects, but no measurements were done during summer. Recycling of treated effluent back to the sedimentation tank did not affect elimination. Area-based rate constants for the vertical flow wetland receiving effluent from the sedimentation tank averaged 3.2 m/d for total coliforms, 3.3 m/d for faecal coliforms and 2.1 m/d for faecal streptococci. The rate constants depended on loading rates. It is suggested that filtration is a major removal mechanism for bacterial indicator organisms in vertical flow constructed wetland systems.

Biodegradation, Environmental↗
PubMed2002

Cosegregation of the mitochondrial DNA A1555G and G4309A mutations results in deafness and mitochondrial myopathy.

We report a patient with progressive external ophthalmoplegia (PEO), exercise intolerance, and deafness after aminoglycoside exposure, harboring two pathogenic mutations in her mtDNA: an A1555G in the 12S rRNA gene and a G4309A in the tRNA(Ile) gene. Muscle histochemistry showed abundant ragged-red fibers, and biochemistry revealed normal respiratory chain function. The A1555G mutation was homoplasmic in blood from the proband and from all maternal relatives. The G4309A mutation was abundant in the proband's muscle, less abundant in her blood, still less abundant in the mother's blood, and absent in blood from other maternal relatives. Family members were asymptomatic. Our data suggest that the former mutation resulted in aminoglycoside-induced deafness and the latter caused PEO plus exercise intolerance.

Adult↗
PubMed2001

Mitochondrial dysfunction associated with a mutation in the Notch3 gene in a CADASIL family.

BACKGROUND: Cerebral autosomal arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is characterized by recurrent subcortical ischemic strokes and dementia caused by mutations in the Notch3 gene. In Drosophila melanogaster, Notch signaling has a pleiotropic effect, affecting most tissues of the organism during development. OBJECTIVE: To characterize a potential mitochondrial dysfunction associated with mutations in the Notch3 gene. METHODS: Biochemical, histochemical, molecular, and genetic analyses were performed on muscle biopsy specimens and fibroblasts obtained from patients of a Spanish family with CADASIL. Additional biochemical and molecular analyses of the N(55e11) mutant of D. melanogaster were performed. RESULTS: In muscle biopsy specimens, a significant decrease was found in the activity of complex I (NADH [reduced form of nicotinamide adenine dinucleotide] dehydrogenase), and in one patient, histochemical analysis showed the presence of ragged-red fibers with abnormal cytochrome c oxidase staining. Reduced fibroblast activity of complex V (ATP synthase) was found. Supporting data on patients with CADASIL, it was found that the mutation N(55e11) in Drosophila decreases the activity of mitochondrial respiratory complexes I and V. CONCLUSIONS: Mitochondrial respiratory chain activity responds, directly or indirectly, to the Notch signaling pathway. Mitochondrial dysfunction in patients with CADASIL may be an epiphenomenon, but results of this study suggest that the pathophysiology of the disease could include a defect in oxidative phosphorylation.

Adult↗
PubMed2001

"All versus nothing" inseparability for two observers.

A recent proof of Bell's theorem without inequalities [A. Cabello, Phys. Rev. Lett. 86, 1911 (2001)] is formulated as a Greenberger-Horne-Zeilinger-type proof involving just two observers. On one hand, this new approach allows us to derive an experimentally testable Bell inequality which is violated by quantum mechanics. On the other hand, it leads to a new state-independent proof of the Kochen-Specker theorem and provides a wider perspective on the relations between the major proofs of no hidden variables.

Journal Article↗
PubMed2001

Bell's theorem without inequalities and without probabilities for two observers.

A proof of Bell's theorem using two maximally entangled states of two qubits is presented. It exhibits a similar logical structure to Hardy's argument of "nonlocality without inequalities." However, it works for 100% of the runs of a certain experiment. Therefore, it can also be viewed as a Greenberger-Horne-Zeilinger-like proof involving only two spacelike separated regions.

Journal Article↗
PubMed2001

Early-onset multisystem mitochondrial disorder caused by a nonsense mutation in the mitochondrial DNA cytochrome C oxidase II gene.

We report the first nonsense mutation (G7896A) in the mtDNA gene for subunit II of cytochrome c oxidase (COX) in a patient with early-onset multisystem disease and COX deficiency in muscle. The mutation was heteroplasmic in muscle, blood, and fibroblasts from the patient and abundantly present in COX-deficient fibers, but less abundant in COX-positive fibers; it was not found in blood samples from the patient's asymptomatic maternal relatives. Immunoblot analysis showed a reduced concentration of both COX II and COX I polypeptides, suggesting impaired assembly of COX holoenzyme.

Child, Preschool↗
PubMed2001

Screening of antimicrobial activities in red, green and brown macroalgae from Gran Canaria (Canary Islands, Spain).

Extracts from 44 species of seaweed from Gran Canaria (Canary Islands, Spain) were screened for the production of antibacterial and antifungal compounds against a panel of gram-negative and gram-positive bacteria, mycobacteria, yeasts and fungi. A total of 28 species displayed antibacterial activity, of which six also showed antifungal activity. Asparagopsis taxiformis and Cymopolia barbata were the species with the strongest activities against the broadest spectrum of target microorganisms. All the species with antibacterial activity were active against gram-positive bacteria, whereas only two species, A. taxiformis and Osmundea hybrida, were active against mycobacteria. The production of secondary metabolites with antimicrobial activities by the macroalgae was also studied under different conditions, although no common trend for bioactivity was observed.

Anti-Bacterial Agents↗