Biomedical subjects
Publications and source records attributed to A Bianchi.
Preparations enriched in human blood B lymphocytes are able to take up polyamines efficiently. Uptake by T cells is barely detectable. Human non-circulating B cells (from tonsils) have a much lower ability to take up polyamines, as do mixed populations of bovine lymph nodes. B cells contain a higher amount of endogenous polyamines and show higher ornithine decarboxylase activity than T cells.
A case of fatal hemorrhage from a fistula penetrating into the right ventricle is reported. The source of the bleeding was a giant ulcer on a Nissen fundoplication performed 5 years previously to relieve gastroesophageal reflux. The pathologic sequence does not seem to have been previously described.
We evaluated the efficacy of tetracycline, minocycline, erythromycin and rokitamycin (rikamycine, TMS-19Q) in controlling in vitro propagation of Chlamydia trachomatis in HeLa 229 cells. Ten recent clinical isolates of Chlamydia trachomatis and one fast-growing strain were tested with inocula of 100-1,000 inclusion forming units per well of a 96-wheel microculture plate. Chlamydia trachomatis inclusions were detected by an immunoperoxidase-antiperoxidase procedure (PAP), including a genus-specific monoclonal antibody. Minimal inhibitory concentration (MIC) geometric means and ranges were respectively 0.128, 0.015-0.25 mg/l tetracycline, 0.001, less than or equal to 0.001-0.004 mg/l minocycline, 0.187, 0.031-0.5 mg/l erythromycin, and 0.005, less than or equal to 0.001-0.062 mg/l rokitamycin; minimal lethal concentration (MLC) geometric means and ranges were 6.79, 0.125-32 mg/l tetracycline, 0.225, 0.062-2 mg/l minocycline, 3.37, 1-32 mg/l erythromycin, and 0.112, 0.031-1 mg/l rokitamycin. Since rokitamycin appears to be the more bactericidal from the four antibiotics tested, clinical studies in sexually transmitted diseases are indicated.
The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.
Interaction of the glycosyl phosphatidylinositol-linked differentiation Ag CD73 (ecto-5'-nucleotidase) with the CD73-specific mAb 1E9 generates agonistic signals that strongly synergize with T cell activation induced by CD3 and CD2 mAb. This synergy is observed only when 1E9 is immobilized on plastic and occurs in the absence of accessory cells or exogenous lymphokines. 1E9 induces a rapid (though transient) increase in [Ca2+]i in a minor proportion (20 to 30%) of unfractionated T lymphocytes (presumably CD73+ cells). However, this [Ca2+]i mobilization is not sufficient to fully activate CD73+ T cells, as shown by the requirement of additional signals such as CD3 or CD2 stimulation to initiate T cell proliferation. These signals cannot be substituted by the exogenous lymphokines, rIL-1, rIL-2, or rIL-4, or PMA (when T cells are rigorously depleted of monocytes). These data indicate that CD73 may behave as an accessory molecule regulating interactions between T cells and antigens or APC. A comparison was carried out with mAb 9.3 to the differentiation Ag CD28, another agonistic molecule with activating properties similar to CD73. Despite their lower percentage, the ability of CD73+ T cells to amplify the proliferation induced by CD3 or CD2 mAb was equivalent or even greater than that of CD28+ T cells. Once activated, CD73+ cells may recruit the remaining (CD73-) cells primed by CD3 or CD2 stimulation. Based on these data, we suggest that CD73+ T lymphocytes may be a specialized subset to amplify immune responses originated by the CD3 and CD2 activation pathways. Finally, the functional association between CD73 and integral membrane molecules like CD3 and CD2 suggests that GPI-anchored molecules may play a role in transmembrane signaling mediated by conventional second messenger systems.
Zonal distribution of insulin stimulation of hepatic protein tyrosine phosphorylation, detected by immunoblotting with an anti-phosphotyrosine antibody, has been studied in the in situ perfused rat liver by dual-digitonin-pulse perfusion. Insulin promotes the rapid and sustained tyrosine phosphorylation of two proteins (pp150 and pp69) that are present only in the perivenous hepatocytes, while three others (pp46, pp48 and pp96) are stimulated identically in the periportal and perivenous cells. The ability of insulin to rapidly activate acetyl-CoA carboxylase is indistinguishable between the hepatic zones. Hepatic zonation of insulin-stimulated tyrosine phosphorylation could underly differential hepatic insulin responses and might provide clues to the identification of tyrosine phosphorylated proteins linked to insulin regulation of intracellular events.
Six patients with extremity osteosarcoma initially underwent successful treatment of the primary tumor with four to seven courses of intraarterial cis-diamminedichloroplatin-II (IA-CDP; 100 to 150 mg/m2/course). The primary tumors in two patients were then extirpated by limb salvage. However, a local soft tissue recurrence occurred in both patients several months later. The other four patients refused surgical intervention and later also developed local bony recurrences. Reinstatement of three to five courses of IA-CDP in all six patients induced a complete response in five. The local recurrences (bony and soft tissue) in all six patients were excised. This included limb-salvage procedures in three patients. Additional postoperative chemotherapy was administered. Four patients remain alive and continuously free of disease 3.5+ to 4.5+ years after retreatment with IA-CDP.
Changes in the mass and subunit structure of liver acetyl-CoA carboxylase (ACC) accompany altered nutrition in vivo. Enzyme activity in different tissues and cell lines is also, in part, determined by variations in both total mass and ACC isoenzyme composition. ACC isoenzyme mass and hetero/homo-isoenzyme association were quantified by three sandwich e.l.i.s.a. assays, i.e. an avidin-based assay that measured total isoenzyme mass and two antibody-sandwich assays which measure polypeptide association. Results from the avidin-based assay reveal that the two major isoenzymes, of molecular mass 265 kDa (ACC 265) and 280 kDa (ACC 280), are present in markedly variable concentration in several rat and mouse tissues and in cell lines of rat and mouse origin. Hepatic ACC mass has been reported to be distributed between mitochondrial and cytosolic fractions and to undergo only a change in subcellular distribution without alteration in total mass on induction/repression of activity in vivo [Roman-Lopez, Shriver, Joseph & Alfred (1989) Biochem. J. 260, 927-930]. However, in the present study, immunoblotting and e.l.i.s.a. analysis reveals that, in rat liver, the mass of both isoenzymes is predominantly cytosolic in distribution, is markedly diminished on fasting and rises 6-8-fold on refeeding of a high-carbohydrate diet. These data support the results of several other investigations of hepatic ACC mass, and are consistent with known nutritionally altered changes in ACC mRNA content. By the two antibody-sandwich e.l.i.s.a. assays, isoenzyme complexes either composed of both ACC 280 and 265 or with multiple copies of ACC 265 are detectable in rat liver enzyme; their concentration varies independently of total ACC mass with the nutritional state of the rat, being lowest in fasting and highest on fasting/refeeding. E.l.i.s.a. analysis, applicable to crude tissue/cell extracts, provides a simple, sensitive and quantitative measurement of ACC mass and subunit composition. Its use may permit needed quantitative insight into the role of variable total ACC and isoenzyme mass and of alterations in ACC subunit composition that occur in vivo or in isolated cells in response to a variety of hormonal and nutritional influences.
Tumor necrosis factor-alpha (TNF) is a cytokine that displays a pleomorphic array of effects on different cell populations. Evidence is presented that TNF may be constitutively produced by B-cell chronic lymphocytic leukemia (B-CLL) and hairy cell leukemia (HCL) cells and that it may play a relevant role in these diseases. These conclusions are based on the presence of circulating levels of TNF in the serum of 20 of the 24 patients tested (83.3%), while undetectable values were found in normal sera. The suggestion that the increased serum levels were due to the leukemic cell population is strengthened by the evidence that purified B-CLL and HCL cells may constitutively release variable degrees of TNF. These levels markedly increase after incubation with interferon gamma or phytohemagglutinin (PHA) plus phorbol myristate acetate (PMA). The cellular release of TNF by primary B-CLL cells was significantly (P less than .001) higher in B-CLL stage O-I patients compared with stage II-III patients. The demonstration that, in B-cell chronic lymphoproliferative disorders, the pathologic cells may release TNF was further confirmed by the presence of the mRNA for this cytokine in primary and/or in pre-activated cells. Recombinant TNF was capable of inducing a proliferative signal only in a minority of cases (4/24); in most cases it was ineffective, and, in a few, it reduced the degree of proliferation. Furthermore, in costimulatory experiments with interleukin-2 and PHA plus PMA, TNF was ineffective. On the other hand, when primary B-CLL cells were incubated in the presence of an anti-TNF antibody, in 8 of 12 independent experiments a 2- to 15-fold increase in thymidine uptake was documented. Taken together, these results suggest that TNF may play a regulatory role in the progression of the neoplastic clone in B-cell chronic lymphoproliferative disorders and may be implicated in some of the side effects associated with these diseases.
Acetyl-CoA carboxylase (ACC) is a major rate-limiting enzyme of fatty acid biosynthesis; its product, malonyl-CoA, also contributes to the regulation of fatty acid oxidation and elongation. Using monospecific antibodies directed against rat liver ACC and N- and C-terminal antipeptide antibodies raised against predicted sequences of the cloned ACC of Mr 265,000, we have identified a unique biotin-containing cytosolic protein of molecular mass 280,000 daltons that is distinct from this 265,000-dalton protein. This protein is uniquely expressed in rat cardiac and skeletal muscle but is co-expressed with the 265,000-dalton protein in rat liver, mammary gland, and brown adipose tissue. In the fed rat, white adipose tissue contains only the 265,000-dalton protein. Like the 265,000-dalton protein, the 280,000-dalton protein is present predominantly in the cytosolic fraction of liver. In the liver, the content of both proteins is diminished on fasting and increases on fasting/refeeding with a high carbohydrate diet. In contrast, the cardiac and skeletal muscle 280,000-dalton protein content is unaltered by nutritional manipulation. Avidin-Sepharose isolates of citrate-dependent ACC from the heart reveal only the 280,000-dalton protein, while white adipose tissue isolates show only the 265,000 form. These species differ in the sensitivity to citrate activation and in the Km for acetyl-CoA. Antibodies reactive with the 280,000-dalton protein on immunoblotting precipitate ACC activity in heart isolates, while white adipose ACC is precipitated only by antibodies specific for the 265,000-dalton species. However, in ACC isolates where both proteins are present, a heteroisozyme complex can be detected both by immunoprecipitation and by a sandwich enzyme-linked immunosorbent assay. We conclude that the 280,000-dalton protein is an isozyme of ACC, distinct from the previously cloned 265,000-dalton species. Its presence in cardiac and skeletal muscle, where fatty acid synthesis rates are low, suggest that it might play alternative roles in these tissues such as regulation of fatty acid oxidation or microsomal fatty acid elongation.
The paper deals with methods of processing ECG and respiration signals which aim at detecting parameters whose values may be correlated to normal and diabetic subjects with or without cardiovascular autonomic neuropathy (CAN). Beat-to-beat R-R duration values of the ECG and discrete series of respiration are obtained from original signals using a recognition algorithm. Power spectrum analysis (autospectra, cross-spectra and coherence via autoregressive modelling) is carried out on segments of about 200 consecutive cardiac cycles. Spectral parameters of the R-R variability signal are obtained as follows: total power, powers of low-frequency (LF) and high-frequency (HF) components, power of the signal which is (or is not) coherent with respiration, in absolute or in percentage values. The experimental protocol considers 40 diabetic patients (21 of whom have diabetic neuropathy) and 14 normals in three different conditions: resting, standing and controlled respiration. The developed spectral parameters seem sensitive enough to differentiate between normal and pathological subjects. These parameters may constitute a quantitative means to be added to the classical diabetic tests for the diagnosis of cardiovascular autonomic neuropathy.
Spectral analysis of short term R-R variability estimated by autoregressive modelling is a recently developed method for the evaluation of cardiovascular autonomic function. This new test also allows to study the interaction on heart rate variability of parasympathetic and sympathetic system. The sensitivity of the method for detection of cardiovascular autonomic neuropathy has been evaluated in a group of diabetic patients in comparison with the sensitivity of a battery of the most commonly used cardiovascular autonomic tests (deep-breathing, lying-to-standing, Valsalva Manoeuvre, postural hypotension and hand grip). Spectral analysis of heart rate variability resulted in a very sensitive method for early detection of diabetic autonomic neuropathy, about one-fourth of diabetic patients with normal traditional cardiovascular autonomic tests had abnormal results at spectral analysis. Both sympathetic and vagal control of heart rate resulted alterated in diabetic autonomic neuropathy.
Recently, the monofunctional furocoumarin 4,4',6-trimethylangelicin (TMA) has been proposed for photochemotherapeutic use. In order to assess its genotoxic potential, the photobiological (genetic) effects of TMA were studied in a diploid strain of Saccharomyces cerevisiae (D7) and compared to those of the bifunctional furocoumarin 8-methoxypsoralen (8-MOP). At equimolar concentrations, the induction of lethal effects by TMA in the presence of equal 365-nm radiation was higher than that exerted by 8-MOP. TMA was also more active than 8-MOP in inducing nuclear events such as nuclear reverse mutation and mitotic recombination (crossing-overs and gene conversion) per unit dose of 365-nm radiation. At equal survival, however, TMA was less efficient in inducing reverse mutation and crossing-over, showing the same activity as 8-MOP in the induction of gene conversion. TMA was more active than 8-MOP in the induction of cytoplasmic 'petite' mutations per unit dose of 365-nm radiation and per viable cell. The high photobiological activity of this monofunctional furocoumarin is mainly related to its strong DNA photobinding but also to the type of monoaddition induced, to the sequential distribution in DNA and to the generation of active forms of oxygen.
Explore the source record for details and available documents.
We evaluated the efficacy of azithromycin, erythromycin and doxycycline in controlling in-vitro propagation of Chlamydia trachomatis in HeLa 229 cells. Eight recent clinical isolates of C. trachomatis and two fast-growing strains were tested with inocula of 10(3)-10(5) inclusion forming units per well of a 96-well microtitre plate. C. trachomatis inclusions were detected by an immunoperoxidase-antiperoxidase procedure (PAP), including a genus-specific monoclonal antibody. MIC ranges were 0.064-0.25 mg/l azithromycin, 0.064-0.128 mg/l erythromycin and 0.016-0.064 mg/l doxycyline; MBC ranges were 2-8 mg/l azithromycin, 4-64 mg/l erythromycin and 0.5-8 mg/l doxycycline. Since azithromycin appears to be effective against C. trachomatis, clinical studies in sexually transmitted diseases are indicated.
The recombinant interleukin-2 (rIL-2) generation of lymphokine-activated killer (LAK) cells was investigated in peripheral blood T lymphocytes (PBT) of 16 patients with monoclonal gammopathy of undetermined significance (MGUS) and 32 patients with multiple myeloma (MM). LAK activity was significantly decreased in MM, but not in MGUS patients, and was partially recovered in MM in the remission phase. This finding was unexpected, because CD8+ CD11b+ cells, which contain LAK precursors, are significantly increased in MM. LAK activity was investigated in purified CD8+ CD11b+ lymphocytes to discriminate between an intrinsic defect or a defective regulation by other T cell subsets. These cells were intrinsically unable to generate LAK activity fully following rIL-2 stimulation. MM showed the more pronounced LAK deficiency, while MGUS patients showed intermediate values. Phenotyping revealed significantly increased proportions of Leu7+ and HLA-DR+ cells in MM patients. These data reveal another dysregulation of T cell effector functions in patients with monoclonal gammopathies and offer further evidence of the impairment of their cell-mediated immunity.
Explore the source record for details and available documents.
In a one year-study, 9 healthy human donors were being supplemented with beta-carotene (BC) plus canthaxanthin (CX), to determine the effect of carotenoids on chromosomal damage (micronuclei) induced in the donors' lymphocyte cell cultures by exposure to bleomycin (BLM), an antineoplastic drug that has been shown to produce chromosomal aberrations through the production of free radicals. The first four months monitoring data, including determination of carotenoid blood levels, are here reported. These data show that carotenoid supplementation significantly decrease (up to 50%) the formation of micronuclei induced by BLM in human lymphocyte cell cultures. This decrease is in correlation with carotenoid blood levels.