Search PubMed⌕ Search

Biomedical subjects

A B Deisseroth

Publications and source records attributed to A B Deisseroth.

At least 109 records · Page 6Linked to original sources
PubMed1993

Genetic therapy of human neoplastic disease.

Molecular biology has provided clinical investigators and basic scientists with the tools to identify those changes present within neoplastic hematopoietic and epithelial cells that lead to the evolution of unregulated patterns of cell growth. This information has made possible the development of therapy that involves genetic modification of either the normal hematopoietic cells (for chemoprotection), or the tumor cells themselves to suppress the growth of these cells. This article will summarize the clinical and laboratory data that is evolving in this area.

Animals↗
PubMed1993

A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter.

We have cloned and functionally characterized the human interferon regulatory factor 1 (IRF-1) gene promoter. The promoter contains a CpG island, with several GC boxes, a CAAT box, but no TATA box. IRF-1 mRNA is strongly induced by gamma interferon (IFN-gamma) but more weakly and transiently by IFN-alpha. There are several putative kappa B motifs and numerous AA(G/A)G(G/T)A and GAAANN motifs throughout the promoter. The IRF-1 promoter is not autoregulated by the IRF-1 gene product. IFN inducibility of the promoter was studied with 5' deletion mutants linked to a heterologous reporter gene. Gel mobility shift assays were used to show IFN-inducible factor binding to the IRF-1 promoter. These studies showed that IFN inducibility is conferred by a novel imperfect inverted-repeat arrangement of two GAAANN motifs within a domain, 130 nucleotides upstream of transcription initiation. This inverted repeat binds a factor upon induction with IFN and can confer IFN inducibility on a heterologous promoter. Conversely, point mutations of the inverted repeat are not IFN inducible when linked to the same heterologous promoter.

Base Sequence↗
PubMed1993

Effect of prior interferon alfa therapy on the outcome of allogeneic bone marrow transplantation for chronic myelogenous leukemia.

PURPOSE: To determine whether prior interferon alfa (IFN-A) treatment affects the outcome of allogeneic bone marrow transplantation. PATIENTS AND METHODS: We analyzed the outcome of 77 patients with chronic myelogenous leukemia (CML) who received transplants from an HLA-identical donor using a total-body irradiation-containing preparative regimen. Engraftment, acute and chronic graft-versus-host disease (GVHD), survival, and disease-free survival were compared between patients who had previously received interferon (IFN+) to those who had not (IFN-). Forty-one patients were transplanted in chronic phase and 36 had more advanced CML. The IFN+ group had received IFN-A in doses of 3 to 5 x 10(6) U/m2 three times a week or more for at least 4 weeks anytime before transplantation. RESULTS: For patients in chronic phase, there were no significant differences between the IFN+ group and the IFN- group in regard to neutrophils recovery more than 1.0 x 10(9)/L (29 v 24), platelet recovery more than 50 x 10(9)/L (33 v 36), incidence of grade II to IV GVHD (23% v 28%), incidence of chronic GVHD (39% v 47%), disease-free survival (46% +/- 11% v 59% +/- 13%), relapse (9% v 11%), or 100-day transplant-related mortality (22% v 16%). In patients with more advanced stage disease, there was also no significant differences between the IFN+ group and the IFN- group in regard to these outcomes. CONCLUSION: Prior treatment with IFN-A did not adversely affect transplant outcome. Further studies are required to better understand the complementary roles of IFN-A and allogeneic bone marrow transplantation for the treatment of CML.

Adolescent↗
PubMed1993

Proliferating cell nuclear antigen (PCNA) expression in chronic lymphocytic leukemia (CLL).

Chronic Lymphocytic Leukemia (CLL) is usually an indolent disorder which in some patients assumes an aggressive clinical course. In order to assess at presentation the prognosis of a given patient, several staging systems and prognostic variables have been proposed including the expression of the Proliferating Cell Nuclear Antigen (PCNA). PCNA is a 36 kd nuclear protein, the regulation of which is cell cycle-dependent. In CLL, PCNA levels correlate with cell proliferation, clinical stage and the lymphocyte doubling time (LDT). Furthermore, preliminary data suggests that PCNA expression may also predict response to Fludarabine-based chemotherapy. Since PCNA is a cofactor for Delta DNA polymerase, PCNA overexpression in CLL may also reflect the intrinsic DNA repair activity of the leukemic cells and thus their resistance to chemotherapy. Further studies aiming at modulation of PCNA expression in CLL cells may clarify this issue and may offer a future new therapeutic strategy with which to treat this disorder.

Antigens, Neoplasm↗
PubMed1993

Low-dose non-glycosylated rhGM-CSF is effective for the treatment of delayed hematopoietic recovery after autologous marrow or peripheral blood stem cell transplantation.

Twenty-six patients with hematologic malignancies (20) or solid tumors (six) were treated with non-glycosylated rhGM-CSF (E. coli) for delayed hematopoietic recovery (granulocytes < 0.1 x 10(9)/l on day 21 or < 0.5 x 10(9)/l on day 28) after autologous marrow or peripheral blood stem cell transplantation. Median pretreatment granulocytes were 0.1 x 10(9)/l (range 0-0.4 x 10(9)/l). Treatment with rhGM-CSF was initiated at 60-250 micrograms/m2 subcutaneously daily with dose escalation every 7 days if there was no response. Within 14 days, 21 (84%) of the 25 evaluable patients achieved granulocytes > 0.5 x 10(9)/l and 17 (68%) had granulocytes > 1.0 x 10(9)/l. For those who responded within 14 days, granulocytes were > 0.5 x 10(9)/l at a median of 3 days (range 1-13) and > 1.0 x 10(9)/l at 6 days (range 2-12). Sixteen of the 23 patients receiving an initial rhGM-CSF dose of 60-125 micrograms/m2 achieved granulocytes > 1.0 x 10(9)/l. Three patients discontinued use of rhGM-CSF because of toxicity, and four patients never recovered despite use of rhGM-CSF doses as high as 1000 micrograms/m2. Graft failure-related mortality was 16% at 4 months after transplantation. These results demonstrate that relatively low doses of non-glycosylated rhGM-CSF administered subcutaneously daily can be used to promote granulocyte recovery in patients with delayed engraftment after autologous transplantation. No beneficial effects were seen on red cell or platelet recovery.

Adolescent↗
PubMed1993

Novel DNA binding of p53 mutants and their role in transcriptional activation.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Amino Acid Sequence↗
PubMed1992

Correlation of CD2 expression with PML gene breakpoints in patients with acute promyelocytic leukemia.

The chromosomal translocation t(15;17)(q22:21) of acute promyelocytic leukemia (APL) fuses PML, a novel gene, with RAR alpha, a retinoic acid receptor gene. PML-RAR hybrid transcripts were studied in 18 cases of APL using RNA-PCR. Two forms were noted: one designated 5', producing a 439-bp chimeric fragment, and a 3' form, producing a pair of fragments of 765 bp and 909 bp. 5' forms were found in 7 of the 18 cases while the other 11 patients expressed the 3' forms. The chromosome 15 specific probes K3 and K2 were used to study genomic breakpoints in 12 APL patients. Comparison of these results with RNA PCR in 11 patients for whom both were available yielded a rearrangement pattern predictive of whether the hybrid transcript was 5' or 3'. In this way, an additional three patients in whom DNA but not RNA was available were identified as having 3' (downstream) breakpoints and, therefore, 3' hybrid forms. Thus, 21 cases categorized as having 5' or 3' PML-RAR transcripts were analyzed for various phenotypic differences. Surface phenotyping of leukemic promyelocytes demonstrated expression of the CD2 antigen in all cases with the 5' splice variant. Only 1 of 11 cases with the 3' form showed CD2 expression. This difference is significant at P = .001.

Adult↗
PubMed1992

Stromal support enhances cell-free retroviral vector transduction of human bone marrow long-term culture-initiating cells.

Gene transfer into hematopoietic stem cells by cell-free virions is a goal for gene therapy of hematolymphoid disorders. Because the hematopoietic microenvironment provided by the stroma is required for stem cell maintenance both in vivo and in vitro, we reasoned that cell-free transduction of bone marrow cells (BMC) may be aided by stromal support. We used two high-titer replication-defective retroviral vectors to differentially mark progenitor cells. The transducing vector was shown to be a specific DNA fragment by polymerase chain reaction of colony-forming cells derived from progenitors maintained in long-term culture (LTC). BMC were infected separately by cell-free virions with or without pre-established, irradiated, allogeneic stromal layers, and in the presence or absence of exogenous growth factors (GF). The GF assessed were interleukin-3 (IL-3) and IL-6 in combination, leukemia inhibitory factor (LIF), mast cell growth factor (MGF), and LIF and MGF in combination. In addition, we developed a competitive LTC system to directly assess the effect of infection conditions on the transduction of clonogenic progenitors as reflected by the presence of a predominate provirus after maintenance in the same microenvironment. The results show gene transfer into human LTC-initiating cells by cell-free retroviral vector and a beneficial effect of stromal support allowing a transduction efficiency of 64.6% in contrast to 15.8% without a supporting stromal layer. A high transduction rate was achieved independent of stimulation with exogenous GF. We propose that autologous marrow stromal support during the transduction period may have application in clinical gene therapy protocols.

Base Sequence↗
PubMed1992

Human interferon regulatory factor 1: intron-exon organization.

Interferon (IFN) regulatory factor 1 (IRF-1) is a transcriptional regulatory protein that mediates the transcriptional activation of the IFN-alpha and IFN-beta genes by viruses and IFNs. To characterize the mechanisms that govern the level of IRF-1 in cells, we isolated the IRF-1 gene and characterized the structure of its intronic and exonic domains and of its regulatory promoter region. A human placental genomic library was screened with an IRF-1 cDNA probe, and two clones that contained the IRF-1 gene and its 5' regulatory region were obtained. We used these clones to determine the complete nucleotide sequence for the IRF-1 gene, finding that the IRF-1 gene spanned 7.72 kb of DNA and included 10 exons and 9 introns. When the deduced amino acid sequences were compared among different species, the most conserved exons were exons 2, 3, and 4, in which the putative DNA binding domain for the IRF-1 protein is located.

Amino Acid Sequence↗
PubMed1992

P53 gene mutations in acute myelogenous leukaemia.

A polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) assay was used to identify the exons which contained point mutations in the conserved regions (exons 4-8) of the p53 gene in 49 acute myelogenous leukaemia (AML) patients. SSCP analysis in our study was consistent with the results of subsequent direct DNA sequencing in detecting point mutational change in exons 5 and 8 of one AML patient and in exons 7 and 8 of two additional AML patients. The mutations were located at codons 245 and 273, which have been found in many other tumours, and codons 178 and 290, which have not been reported previously. All of the p53 proteins in which we detected point mutations were immunoprecipitated by the p53 monoclonal antibody PAb 240, which has been shown to recognize a mutant conformation of p53 protein. Thus, our results indicate that functional inactivation of the p53 gene by point mutational change might be one of the mechanisms underlying disease progression of AML.

Base Sequence↗
PubMed1992

Use of autotransplants in chronic myeloid leukaemia.

Patients with newly diagnosed CML have Ph-negative stem cells in their marrow and peripheral blood. A minority can be restored to durable Ph-negative haemopoiesis by treatment with interferon-alpha but in general autografting with marrow collected after IFN treatment has not proved feasible. Some patients autografted with blood-derived stem cells collected in chronic phase have achieved durable Ph-negative haemopoiesis and selected patients autografted with 10-day incubated marrow cells have also achieved complete remission. An alternative approach involves collection and isolation of Ph-negative stem cells that may then be used for autografting. Different lines of evidence suggest that induction of remission for all patients with CML should be an attainable goal.

Blood Transfusion↗
PubMed1992

Comparison of in vivo and in vitro effects of granulocyte-macrophage colony-stimulating factor (GM-CSF) in patients with acute myeloid leukemia.

We studied the in vitro effects of granulocyte-macrophage colony-stimulating factor (GM-CSF) in 13 patients with acute myeloid leukemia (AML) and one patient with refractory anemia with excess of blasts in transformation using the AML blast (AML colony-forming units, AML-CFU) and mixed (granulocyte erythrocyte macrophage megakaryocyte colony-forming units, CFU-GEMM) colony culture assays. In parallel, these patients received GM-CSF s.c. at 125 micrograms/m2/day, or in escalated doses starting with 10 micrograms/m2/day for a week or until circulating blast counts reached 50 x 10(9)/liter, in an effort to sensitize leukemic blasts to cell-cycle-specific agents. Results of in vivo GM-CSF treatment were correlated with those of in vitro assays. In 9 of 12 patients (75%), GM-CSF treatment increased peripheral blood blast counts (in vivo effect). GM-CSF also stimulated in vitro AML blast colony proliferation in these nine patients and increased the S+G2M phases of the cell cycle in five out of five of these patients' samples. Two of three patients in whom an in vivo response could not be demonstrated also failed to have a detectable in vitro response. These observations suggest that the AML blast colony culture assay may be useful in predicting the response of AML to cytokine therapy. Finally, GM-CSF stimulated granulocyte-macrophage (granulocyte-macrophage colony-forming units, CFU-GM) and erythroid (erythroid burst-forming units, BFU-E) colony proliferation in 14 and 11 patients, respectively, including the 3 individuals who demonstrated no clinical effect on blast counts. It is, therefore, possible that GM-CSF may be used to stimulate proliferation of progenitors that differentiate into mature granulocyte, monocyte-macrophage, and erythroid cells.

Acute Disease↗
PubMed1992

The effect of granulocyte-macrophage colony-stimulating factor on undifferentiated and mature acute myelogenous leukemia blast progenitors.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) has been used recently to recruit undifferentiated acute myelogenous leukemia (AML) blasts into the S-phase of the cell cycle and increase the fraction of cells killed by cell cycle-specific drugs. Using three AML blast colony assays combined with a suspension culture (delta assay), we determined the in vitro effect of GM-CSF on mature and undifferentiated AML blast progenitors obtained from bone marrow aspirates of six AML patients. GM-CSF stimulated AML blast colony proliferation at a concentration of 5 ng/ml in the methylcellulose and the agar clonogenic assays in six of six AML marrow samples. However, in the delta assay, which selects for immature AML progenitors, GM-CSF did not affect AML blast colony-forming cells in five of six AML marrow samples at concentrations ranging from 5 to 300 ng/ml. Our data imply that GM-CSF stimulates mature but not undifferentiated AML blast progenitors. It is therefore possible that GM-CSF may not be beneficial as a recruiting agent in most AML patients.

Adult↗